Incidental Mutation 'R7956:Dera'
ID 649820
Institutional Source Beutler Lab
Gene Symbol Dera
Ensembl Gene ENSMUSG00000030225
Gene Name deoxyribose-phosphate aldolase (putative)
Synonyms 2010002D22Rik, 2500002K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7956 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 137754546-137857340 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 137836828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 282 (T282M)
Ref Sequence ENSEMBL: ENSMUSP00000084959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087675] [ENSMUST00000203216] [ENSMUST00000203693]
AlphaFold Q91YP3
Predicted Effect probably benign
Transcript: ENSMUST00000087675
AA Change: T282M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084959
Gene: ENSMUSG00000030225
AA Change: T282M

DomainStartEndE-ValueType
DeoC 49 299 1.16e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203216
AA Change: T80M

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145264
Gene: ENSMUSG00000030225
AA Change: T80M

DomainStartEndE-ValueType
Pfam:DeoC 2 97 1e-6 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000203693
SMART Domains Protein: ENSMUSP00000144935
Gene: ENSMUSG00000030225

DomainStartEndE-ValueType
DeoC 49 271 4.4e-50 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000204723
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Cxxc1 T G 18: 74,218,983 probably null Het
D10Jhu81e T C 10: 78,163,571 probably null Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gne T A 4: 44,044,962 I391L probably benign Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gpr22 G T 12: 31,709,220 T301K possibly damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lrp1b A C 2: 41,282,149 probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Olfr706 G A 7: 106,885,971 T282I possibly damaging Het
Otogl T C 10: 107,878,026 I511V possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Sorl1 A G 9: 41,989,359 Y1686H probably damaging Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tek T G 4: 94,799,343 probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Dera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Dera APN 6 137830271 missense probably damaging 1.00
IGL02220:Dera APN 6 137780817 splice site probably null
IGL02449:Dera APN 6 137780817 splice site probably null
IGL03256:Dera APN 6 137779645 missense probably benign 0.00
R0644:Dera UTSW 6 137783048 missense probably benign 0.10
R0691:Dera UTSW 6 137796747 intron probably benign
R0733:Dera UTSW 6 137796848 missense probably damaging 1.00
R1478:Dera UTSW 6 137830195 missense possibly damaging 0.91
R3950:Dera UTSW 6 137837120 missense probably damaging 0.99
R3951:Dera UTSW 6 137837120 missense probably damaging 0.99
R3952:Dera UTSW 6 137837120 missense probably damaging 0.99
R4561:Dera UTSW 6 137780738 missense possibly damaging 0.83
R7687:Dera UTSW 6 137836880 missense
R8676:Dera UTSW 6 137830204 missense probably damaging 1.00
Z1088:Dera UTSW 6 137837118 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAAATAGGCCCCTCCCTTTG -3'
(R):5'- ACGCCTTTCAGCAGAATTTAC -3'

Sequencing Primer
(F):5'- CCTCCCTTTGCTGAGGTGAAAAAG -3'
(R):5'- CACCTGATCTATATAACTGATGCAGC -3'
Posted On 2020-09-15