Incidental Mutation 'R7956:Sorl1'
ID 649834
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms 2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 046000-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R7956 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 41964720-42124297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41989359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1686 (Y1686H)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: Y1686H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: Y1686H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Cxxc1 T G 18: 74,218,983 probably null Het
D10Jhu81e T C 10: 78,163,571 probably null Het
Dera C T 6: 137,836,828 T282M probably benign Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gne T A 4: 44,044,962 I391L probably benign Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gpr22 G T 12: 31,709,220 T301K possibly damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lrp1b A C 2: 41,282,149 probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Olfr706 G A 7: 106,885,971 T282I possibly damaging Het
Otogl T C 10: 107,878,026 I511V possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tek T G 4: 94,799,343 probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8219:Sorl1 UTSW 9 42041561 splice site probably null
R8261:Sorl1 UTSW 9 42014481 missense probably damaging 1.00
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8524:Sorl1 UTSW 9 41974074 missense probably damaging 1.00
R8869:Sorl1 UTSW 9 42022426 missense probably benign 0.01
R8898:Sorl1 UTSW 9 42000271 missense probably damaging 1.00
R8972:Sorl1 UTSW 9 42046552 missense probably damaging 1.00
R9012:Sorl1 UTSW 9 42071195 missense probably damaging 1.00
R9094:Sorl1 UTSW 9 42063754 missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41974124 nonsense probably null
R9278:Sorl1 UTSW 9 42046561 missense probably benign 0.01
R9288:Sorl1 UTSW 9 42041631 missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41989443 missense probably damaging 1.00
R9330:Sorl1 UTSW 9 42067933 missense probably damaging 1.00
R9332:Sorl1 UTSW 9 42001518 missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42124088 missense probably benign 0.20
R9528:Sorl1 UTSW 9 42022335 critical splice donor site probably null
R9544:Sorl1 UTSW 9 42081809 nonsense probably null
R9563:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9564:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9588:Sorl1 UTSW 9 42081809 nonsense probably null
R9634:Sorl1 UTSW 9 41996294 missense probably benign
R9671:Sorl1 UTSW 9 42031781 missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42092470 missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGTAAAGGCTCACACGGG -3'
(R):5'- GTCCTAACTGCTTGCTGGTAGAG -3'

Sequencing Primer
(F):5'- ACTTGAGAGGATCTAGACTCCCCTG -3'
(R):5'- AACTGCTTGCTGGTAGAGTCTCTC -3'
Posted On 2020-09-15