Incidental Mutation 'R0322:Mdm2'
Institutional Source Beutler Lab
Gene Symbol Mdm2
Ensembl Gene ENSMUSG00000020184
Gene Nametransformed mouse 3T3 cell double minute 2
SynonymsMdm-2, 1700007J15Rik
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0322 (G1)
Quality Score160
Status Validated
Chromosomal Location117688875-117710758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117702204 bp
Amino Acid Change Histidine to Glutamine at position 96 (H96Q)
Ref Sequence ENSEMBL: ENSMUSP00000137039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020408] [ENSMUST00000105263] [ENSMUST00000155285]
Predicted Effect probably benign
Transcript: ENSMUST00000020408
AA Change: H96Q

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020408
Gene: ENSMUSG00000020184
AA Change: H96Q

Pfam:SWIB 26 101 1.3e-11 PFAM
low complexity region 145 166 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:zf-RanBP 297 326 1.7e-10 PFAM
low complexity region 390 410 N/A INTRINSIC
RING 436 476 2.42e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105263
AA Change: H47Q

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100898
Gene: ENSMUSG00000020184
AA Change: H47Q

Pfam:SWIB 1 53 5e-15 PFAM
low complexity region 96 117 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
Pfam:zf-RanBP 248 277 5.7e-10 PFAM
low complexity region 341 361 N/A INTRINSIC
RING 387 427 2.42e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147823
Predicted Effect possibly damaging
Transcript: ENSMUST00000155285
AA Change: H96Q

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137039
Gene: ENSMUSG00000020184
AA Change: H96Q

Pfam:SWIB 27 102 3.1e-22 PFAM
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice homozygous for a null allele exhibit prenatal lethality. Mice homozygous for one knock-in allele exhibit embryonic lethality while mice homozygous for a different knock-in allele exhibit alters cell cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Mdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Mdm2 APN 10 117702299 missense possibly damaging 0.91
IGL02102:Mdm2 APN 10 117692717 missense possibly damaging 0.93
Xi-an UTSW 10 117709789 splice site probably null
PIT1430001:Mdm2 UTSW 10 117694935 missense probably damaging 1.00
R1589:Mdm2 UTSW 10 117690529 missense probably benign 0.01
R1766:Mdm2 UTSW 10 117696022 missense probably damaging 1.00
R3153:Mdm2 UTSW 10 117709713 missense possibly damaging 0.90
R4384:Mdm2 UTSW 10 117696439 missense possibly damaging 0.67
R4411:Mdm2 UTSW 10 117709789 splice site probably null
R5111:Mdm2 UTSW 10 117691221 missense possibly damaging 0.94
R5509:Mdm2 UTSW 10 117690612 missense probably damaging 1.00
R5578:Mdm2 UTSW 10 117702287 missense possibly damaging 0.81
R5727:Mdm2 UTSW 10 117702307 missense possibly damaging 0.77
R6382:Mdm2 UTSW 10 117692721 missense probably benign 0.31
R7506:Mdm2 UTSW 10 117690691 missense possibly damaging 0.94
R8363:Mdm2 UTSW 10 117690334 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agaactggcagtaccaacag -3'
Posted On2013-08-08