Incidental Mutation 'R7956:Otogl'
ID649840
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7956 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107878026 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 511 (I511V)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165341
AA Change: I511V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: I511V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Dera C T 6: 137,836,828 T282M probably benign Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gne T A 4: 44,044,962 I391L probably benign Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gpr22 G T 12: 31,709,220 T301K possibly damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Olfr706 G A 7: 106,885,971 T282I possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Sorl1 A G 9: 41,989,359 Y1686H probably damaging Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
R8428:Otogl UTSW 10 107798736 missense probably damaging 1.00
R8444:Otogl UTSW 10 107857114 missense probably benign 0.01
R8501:Otogl UTSW 10 107790560 missense probably benign
R8503:Otogl UTSW 10 107892126 missense probably damaging 1.00
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GACCAATGGTGAGCATTATTCATTC -3'
(R):5'- TGCACCGAACATGACTGTCC -3'

Sequencing Primer
(F):5'- GGTGAGCATTATTCATTCTTTTGAG -3'
(R):5'- GCATTAACACGGGTTTTCATTTC -3'
Posted On2020-09-15