Incidental Mutation 'R7956:Gpr22'
ID649848
Institutional Source Beutler Lab
Gene Symbol Gpr22
Ensembl Gene ENSMUSG00000044067
Gene NameG protein-coupled receptor 22
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7956 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31706867-31713947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31709220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 301 (T301K)
Ref Sequence ENSEMBL: ENSMUSP00000056125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000057783
AA Change: T301K

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: T301K

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:7tm_1 95 403 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174480
SMART Domains Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 186 3.3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176710
AA Change: T264K

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067
AA Change: T264K

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 366 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Cxxc1 T G 18: 74,218,983 probably null Het
D10Jhu81e T C 10: 78,163,571 probably null Het
Dera C T 6: 137,836,828 T282M probably benign Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gne T A 4: 44,044,962 I391L probably benign Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lrp1b A C 2: 41,282,149 probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Olfr706 G A 7: 106,885,971 T282I possibly damaging Het
Otogl T C 10: 107,878,026 I511V possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Sorl1 A G 9: 41,989,359 Y1686H probably damaging Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tek T G 4: 94,799,343 probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Gpr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gpr22 APN 12 31708710 unclassified probably benign
IGL01521:Gpr22 APN 12 31708710 unclassified probably benign
IGL01533:Gpr22 APN 12 31708710 unclassified probably benign
IGL01585:Gpr22 APN 12 31709337 missense probably benign 0.23
IGL01601:Gpr22 APN 12 31710045 splice site probably benign
IGL01608:Gpr22 APN 12 31708780 nonsense probably null
IGL02307:Gpr22 APN 12 31708740 missense possibly damaging 0.95
IGL02440:Gpr22 APN 12 31709140 missense probably damaging 0.99
IGL02863:Gpr22 APN 12 31710007 missense probably benign 0.36
IGL03163:Gpr22 APN 12 31709172 missense possibly damaging 0.68
R0078:Gpr22 UTSW 12 31711641 missense probably benign
R0358:Gpr22 UTSW 12 31709982 missense probably benign 0.03
R0395:Gpr22 UTSW 12 31709462 missense possibly damaging 0.48
R0452:Gpr22 UTSW 12 31708794 missense possibly damaging 0.69
R0729:Gpr22 UTSW 12 31709313 missense probably damaging 1.00
R1295:Gpr22 UTSW 12 31709514 missense probably benign 0.01
R1991:Gpr22 UTSW 12 31709203 missense probably benign
R4201:Gpr22 UTSW 12 31708913 nonsense probably null
R5203:Gpr22 UTSW 12 31709788 missense probably damaging 1.00
R5505:Gpr22 UTSW 12 31709725 missense probably damaging 1.00
R5541:Gpr22 UTSW 12 31709349 missense probably damaging 0.97
R6218:Gpr22 UTSW 12 31711617 nonsense probably null
R6844:Gpr22 UTSW 12 31709952 missense probably benign
R7448:Gpr22 UTSW 12 31709515 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGGCCTAAACATAGAATGGTG -3'
(R):5'- AGCTCGGGATGTACTATCACC -3'

Sequencing Primer
(F):5'- CAGAAATTGGTGTCCAACAGAG -3'
(R):5'- AGCTCGGGATGTACTATCACCTTTTG -3'
Posted On2020-09-15