Incidental Mutation 'R7957:Olfr358'
ID649874
Institutional Source Beutler Lab
Gene Symbol Olfr358
Ensembl Gene ENSMUSG00000075379
Gene Nameolfactory receptor 358
SynonymsMOR159-4, GA_x6K02T2NLDC-33697309-33696317
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37002163-37009335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37004960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 218 (I218T)
Ref Sequence ENSEMBL: ENSMUSP00000150781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100146] [ENSMUST00000213218] [ENSMUST00000216437]
Predicted Effect probably benign
Transcript: ENSMUST00000100146
AA Change: I218T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097724
Gene: ENSMUSG00000075379
AA Change: I218T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 214 4.7e-7 PFAM
Pfam:7tm_1 41 289 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213218
Predicted Effect probably benign
Transcript: ENSMUST00000216437
AA Change: I218T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Olfr358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Olfr358 APN 2 37004930 missense probably benign 0.00
IGL01460:Olfr358 APN 2 37004636 missense probably benign 0.06
IGL02066:Olfr358 APN 2 37005309 missense probably damaging 1.00
R0081:Olfr358 UTSW 2 37005450 missense probably damaging 1.00
R0129:Olfr358 UTSW 2 37005045 nonsense probably null
R1441:Olfr358 UTSW 2 37005119 missense possibly damaging 0.82
R1543:Olfr358 UTSW 2 37005127 missense probably damaging 1.00
R1628:Olfr358 UTSW 2 37004726 missense probably damaging 1.00
R1966:Olfr358 UTSW 2 37004948 missense possibly damaging 0.49
R2338:Olfr358 UTSW 2 37005147 missense probably damaging 1.00
R4826:Olfr358 UTSW 2 37005333 missense probably damaging 0.99
R6271:Olfr358 UTSW 2 37005542 missense probably damaging 1.00
R7359:Olfr358 UTSW 2 37005437 missense probably damaging 1.00
R7487:Olfr358 UTSW 2 37004774 missense probably damaging 0.98
R8413:Olfr358 UTSW 2 37005390 missense probably damaging 1.00
R8417:Olfr358 UTSW 2 37004646 missense probably benign
R8427:Olfr358 UTSW 2 37004782 nonsense probably null
R8477:Olfr358 UTSW 2 37005048 missense probably benign 0.40
RF007:Olfr358 UTSW 2 37005174 missense probably damaging 0.99
X0028:Olfr358 UTSW 2 37005599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAATCTGTCGATCCTGG -3'
(R):5'- CTGCGAATAACATTGACCTCATGG -3'

Sequencing Primer
(F):5'- CAATCTGTCGATCCTGGTTTAAG -3'
(R):5'- GGTGGTCAGCCTTAACAGTCTC -3'
Posted On2020-09-15