Incidental Mutation 'R7957:Ilf2'
ID649878
Institutional Source Beutler Lab
Gene Symbol Ilf2
Ensembl Gene ENSMUSG00000001016
Gene Nameinterleukin enhancer binding factor 2
SynonymsTex261, 6230405A16Rik, TEG-267, Tex267
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90476126-90488379 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 90487470 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 342 (E342*)
Ref Sequence ENSEMBL: ENSMUSP00000001042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001042] [ENSMUST00000149884] [ENSMUST00000184877] [ENSMUST00000185005]
PDB Structure Crystal structure of the NF90-NF45 dimerisation domain complex [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with ATP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with UTP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with CTP [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000001042
AA Change: E342*
SMART Domains Protein: ENSMUSP00000001042
Gene: ENSMUSG00000001016
AA Change: E342*

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
DZF 98 338 5.01e-142 SMART
low complexity region 353 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149884
SMART Domains Protein: ENSMUSP00000122090
Gene: ENSMUSG00000001018

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:Snapin_Pallidin 23 110 5.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184877
SMART Domains Protein: ENSMUSP00000139315
Gene: ENSMUSG00000001018

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185005
SMART Domains Protein: ENSMUSP00000139160
Gene: ENSMUSG00000001018

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Ilf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ilf2 APN 3 90484542 missense probably damaging 1.00
R0193:Ilf2 UTSW 3 90481339 splice site probably null
R0746:Ilf2 UTSW 3 90482807 missense probably damaging 1.00
R1888:Ilf2 UTSW 3 90487460 unclassified probably benign
R3912:Ilf2 UTSW 3 90487060 missense probably benign 0.07
R4441:Ilf2 UTSW 3 90487462 missense probably benign 0.18
X0011:Ilf2 UTSW 3 90487475 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGGAGGCTTTAGGAAGATCC -3'
(R):5'- CCATCTAAAGCCCCATGGTG -3'

Sequencing Primer
(F):5'- GGAAGATCCTTGGCCAGG -3'
(R):5'- TAAAGCCCCATGGTGGCTGG -3'
Posted On2020-09-15