Incidental Mutation 'R7957:Tlr12'
List |< first << previous [record 45 of 52] next >> last >|
ID649880
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Nametoll-like receptor 12
SynonymsLOC384059, Tlr11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128615443-128618619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128616690 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 589 (G589D)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
Predicted Effect probably benign
Transcript: ENSMUST00000074829
AA Change: G589D

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: G589D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128617422 missense probably benign 0.00
IGL00654:Tlr12 APN 4 128617440 missense probably benign 0.27
IGL01290:Tlr12 APN 4 128617837 missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128616339 nonsense probably null
IGL01550:Tlr12 APN 4 128615742 missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128617389 missense probably benign 0.00
IGL02592:Tlr12 APN 4 128617686 missense probably benign 0.02
IGL02635:Tlr12 APN 4 128616816 missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128617713 missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128615892 missense probably benign 0.01
IGL03131:Tlr12 APN 4 128615877 missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128616852 missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128615937 missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128616291 missense probably benign 0.05
R1536:Tlr12 UTSW 4 128617752 missense possibly damaging 0.95
R1807:Tlr12 UTSW 4 128617436 missense probably benign 0.21
R1989:Tlr12 UTSW 4 128617069 missense probably benign 0.04
R2905:Tlr12 UTSW 4 128616009 missense probably damaging 1.00
R3870:Tlr12 UTSW 4 128616568 missense probably benign 0.00
R4026:Tlr12 UTSW 4 128616508 missense probably benign 0.00
R4296:Tlr12 UTSW 4 128617788 missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128616195 missense probably benign 0.09
R4528:Tlr12 UTSW 4 128618025 missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128615770 missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128617332 missense probably benign 0.06
R4999:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R5054:Tlr12 UTSW 4 128617270 nonsense probably null
R5177:Tlr12 UTSW 4 128618376 missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128616709 nonsense probably null
R5533:Tlr12 UTSW 4 128615863 missense probably damaging 0.99
R6484:Tlr12 UTSW 4 128616054 missense probably damaging 1.00
R6568:Tlr12 UTSW 4 128617992 missense probably benign 0.10
R6821:Tlr12 UTSW 4 128616892 missense possibly damaging 0.95
R7465:Tlr12 UTSW 4 128616170 missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R7810:Tlr12 UTSW 4 128616708 missense probably benign 0.00
R8258:Tlr12 UTSW 4 128617699 missense probably benign 0.38
R8259:Tlr12 UTSW 4 128617699 missense probably benign 0.38
R8377:Tlr12 UTSW 4 128615773 missense probably benign
R8422:Tlr12 UTSW 4 128616634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGTTTGACTCCAGAATG -3'
(R):5'- AACAGCTTGGATGCCTTCTG -3'

Sequencing Primer
(F):5'- CTCCAGAATGTATATATAGTGGGGC -3'
(R):5'- GGATGCCTTCTGCTCCCAG -3'
Posted On2020-09-15