Incidental Mutation 'R7957:Park7'
ID649881
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R7957 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150903884 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000030805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect probably damaging
Transcript: ENSMUST00000030805
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105673
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105674
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105675
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105676
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128075
AA Change: S85P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134751
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146184
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
stiffed UTSW 4 150907090 missense possibly damaging 0.82
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R2416:Park7 UTSW 4 150908401 missense probably benign 0.01
R3032:Park7 UTSW 4 150901052 missense probably benign 0.00
R4638:Park7 UTSW 4 150907099 nonsense probably null
R5345:Park7 UTSW 4 150908423 splice site probably benign
R6585:Park7 UTSW 4 150905264 missense probably benign 0.01
R8155:Park7 UTSW 4 150907090 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGACACGAGTTCATGCCACC -3'
(R):5'- TACGTGCCTTGGTGACATTGC -3'

Sequencing Primer
(F):5'- CGAGTTCATGCCACCCAAAC -3'
(R):5'- CACTGTGGTGGGCCTTTCC -3'
Posted On2020-09-15