Incidental Mutation 'R7957:Ints13'
List |< first << previous [record 18 of 52] next >> last >|
ID649884
Institutional Source Beutler Lab
Gene Symbol Ints13
Ensembl Gene ENSMUSG00000040250
Gene Nameintegrator complex subunit 13
SynonymsSpata30, 4933424B01Rik, Asun
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146549632-146577835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146550766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 652 (S652P)
Ref Sequence ENSEMBL: ENSMUSP00000032427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032427] [ENSMUST00000203545]
Predicted Effect probably damaging
Transcript: ENSMUST00000032427
AA Change: S652P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032427
Gene: ENSMUSG00000040250
AA Change: S652P

DomainStartEndE-ValueType
Pfam:DUF2151 4 692 8.2e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131662
SMART Domains Protein: ENSMUSP00000118000
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 1 394 7.2e-171 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122279
Gene: ENSMUSG00000040250
AA Change: S175P

DomainStartEndE-ValueType
Pfam:DUF2151 2 216 1.6e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203545
AA Change: S273P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145229
Gene: ENSMUSG00000040250
AA Change: S273P

DomainStartEndE-ValueType
Pfam:DUF2151 1 96 3.8e-48 PFAM
Pfam:DUF2151 94 313 6e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Ints13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ints13 APN 6 146565676 missense probably damaging 1.00
IGL02085:Ints13 APN 6 146549939 utr 3 prime probably benign
IGL02439:Ints13 APN 6 146554223 splice site probably benign
IGL02512:Ints13 APN 6 146576357 missense probably damaging 1.00
IGL02523:Ints13 APN 6 146557611 missense probably benign 0.09
IGL02988:Ints13 APN 6 146556148 missense possibly damaging 0.49
R0083:Ints13 UTSW 6 146550664 missense probably benign 0.06
R0085:Ints13 UTSW 6 146574787 splice site probably benign
R0184:Ints13 UTSW 6 146555044 missense probably benign 0.26
R0656:Ints13 UTSW 6 146552461 missense probably benign 0.19
R1808:Ints13 UTSW 6 146554197 missense probably damaging 1.00
R1838:Ints13 UTSW 6 146566611 missense possibly damaging 0.92
R1906:Ints13 UTSW 6 146552370 critical splice donor site probably null
R2140:Ints13 UTSW 6 146576431 missense probably damaging 1.00
R3082:Ints13 UTSW 6 146574707 missense possibly damaging 0.92
R5568:Ints13 UTSW 6 146576357 missense probably damaging 1.00
R5757:Ints13 UTSW 6 146550106 missense probably benign 0.01
R5770:Ints13 UTSW 6 146555073 missense probably damaging 0.98
R5809:Ints13 UTSW 6 146576349 missense probably benign 0.06
R6273:Ints13 UTSW 6 146565681 missense probably damaging 1.00
R6882:Ints13 UTSW 6 146563441 missense probably null 0.18
R6908:Ints13 UTSW 6 146555033 missense probably damaging 0.99
R7089:Ints13 UTSW 6 146574718 missense probably damaging 1.00
R7425:Ints13 UTSW 6 146574700 critical splice donor site probably null
R7660:Ints13 UTSW 6 146557338 missense probably benign 0.24
R8529:Ints13 UTSW 6 146563428 missense probably damaging 0.98
R8847:Ints13 UTSW 6 146556133 missense probably benign 0.01
RF011:Ints13 UTSW 6 146556240 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAGCAGTTTCATTACAGGAC -3'
(R):5'- GTCTACCTACACTGCCTTTAAGG -3'

Sequencing Primer
(F):5'- GCAGTTTCATTACAGGACTACAC -3'
(R):5'- CCTTTAAGGCTGTTTTTCCTAAGTG -3'
Posted On2020-09-15