Incidental Mutation 'R7957:Cnot3'
ID649885
Institutional Source Beutler Lab
Gene Symbol Cnot3
Ensembl Gene ENSMUSG00000035632
Gene NameCCR4-NOT transcription complex, subunit 3
SynonymsA930039N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3645268-3661109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3658222 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 577 (P577T)
Ref Sequence ENSEMBL: ENSMUSP00000039098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019878] [ENSMUST00000038913] [ENSMUST00000160200]
Predicted Effect probably benign
Transcript: ENSMUST00000019878
SMART Domains Protein: ENSMUSP00000019878
Gene: ENSMUSG00000078813

DomainStartEndE-ValueType
Cir_N 8 44 2.43e-9 SMART
low complexity region 94 109 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
coiled coil region 198 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038913
AA Change: P577T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632
AA Change: P577T

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132344
SMART Domains Protein: ENSMUSP00000117297
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 189 8.9e-77 PFAM
low complexity region 214 231 N/A INTRINSIC
SCOP:d1cpo_2 260 335 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135977
SMART Domains Protein: ENSMUSP00000118822
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 78 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160200
SMART Domains Protein: ENSMUSP00000124810
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:NOT2_3_5 1 83 3.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show defective outgrowth of the inner cell mass and complete embryonic lethality at implantation. Heterozygotes exhibit decreased cardiac muscle contractility and develop severe cardiomyopathy leading to heart failure in response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Cnot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cnot3 APN 7 3650855 missense probably damaging 1.00
IGL02231:Cnot3 APN 7 3658210 missense probably benign 0.00
IGL02476:Cnot3 APN 7 3658068 missense probably benign 0.01
IGL03102:Cnot3 APN 7 3656156 nonsense probably null
IGL03181:Cnot3 APN 7 3653248 missense probably damaging 1.00
secondary UTSW 7 3651919 missense probably damaging 1.00
R4531:Cnot3 UTSW 7 3658074 missense probably benign
R4564:Cnot3 UTSW 7 3653258 missense probably damaging 1.00
R5071:Cnot3 UTSW 7 3650861 missense probably damaging 1.00
R5649:Cnot3 UTSW 7 3658083 missense probably benign 0.08
R5869:Cnot3 UTSW 7 3644930 unclassified probably benign
R6120:Cnot3 UTSW 7 3645336 splice site probably null
R6759:Cnot3 UTSW 7 3651919 missense probably damaging 1.00
R7305:Cnot3 UTSW 7 3645480 start gained probably benign
R7369:Cnot3 UTSW 7 3653331 missense possibly damaging 0.77
R7860:Cnot3 UTSW 7 3655566 splice site probably null
R8172:Cnot3 UTSW 7 3658725 missense possibly damaging 0.64
R8415:Cnot3 UTSW 7 3658688 missense probably benign 0.01
R8693:Cnot3 UTSW 7 3653523 missense probably benign 0.16
RF010:Cnot3 UTSW 7 3656069 missense probably benign 0.01
Z1177:Cnot3 UTSW 7 3651495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTATTGAGGACCCTGTG -3'
(R):5'- TAGTCTCTCAGGACCCAGGAAC -3'

Sequencing Primer
(F):5'- TATTGAGGACCCTGTGCCAAC -3'
(R):5'- AGCTCCTCCCTCAGACTGG -3'
Posted On2020-09-15