Incidental Mutation 'R7957:Zfp93'
ID649887
Institutional Source Beutler Lab
Gene Symbol Zfp93
Ensembl Gene ENSMUSG00000055305
Gene Namezinc finger protein 93
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24270420-24277794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24275574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 328 (L328P)
Ref Sequence ENSEMBL: ENSMUSP00000032696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032696] [ENSMUST00000108438]
Predicted Effect probably damaging
Transcript: ENSMUST00000032696
AA Change: L328P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032696
Gene: ENSMUSG00000055305
AA Change: L328P

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108438
AA Change: L328P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104077
Gene: ENSMUSG00000055305
AA Change: L328P

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Other mutations in Zfp93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Zfp93 APN 7 24275692 missense probably damaging 1.00
IGL02939:Zfp93 APN 7 24275084 missense possibly damaging 0.86
IGL02956:Zfp93 APN 7 24274975 missense probably benign 0.25
FR4342:Zfp93 UTSW 7 24275586 missense possibly damaging 0.92
FR4737:Zfp93 UTSW 7 24275389 small deletion probably benign
R0099:Zfp93 UTSW 7 24275475 missense probably benign 0.01
R0376:Zfp93 UTSW 7 24275861 missense probably damaging 1.00
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1511:Zfp93 UTSW 7 24275731 nonsense probably null
R1628:Zfp93 UTSW 7 24274857 missense probably benign 0.00
R4581:Zfp93 UTSW 7 24275668 missense probably damaging 1.00
R4977:Zfp93 UTSW 7 24275411 missense probably benign 0.00
R5162:Zfp93 UTSW 7 24276332 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6284:Zfp93 UTSW 7 24275629 nonsense probably null
R6471:Zfp93 UTSW 7 24273329 missense probably damaging 1.00
R6694:Zfp93 UTSW 7 24275913 missense probably damaging 1.00
R6969:Zfp93 UTSW 7 24275381 nonsense probably null
R7543:Zfp93 UTSW 7 24275108 missense probably benign 0.13
R7623:Zfp93 UTSW 7 24276369 missense probably damaging 1.00
R7763:Zfp93 UTSW 7 24275218 missense possibly damaging 0.56
R8157:Zfp93 UTSW 7 24276460 nonsense probably null
R8194:Zfp93 UTSW 7 24276054 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGTGTCCCCATTCAACCAAGTG -3'
(R):5'- ACTGGAGGCATGACTGAAGC -3'

Sequencing Primer
(F):5'- TTCAACCAAGTGTTCATCCAGG -3'
(R):5'- GTTGCCACTTAAGCTGAAGC -3'
Posted On2020-09-15