Incidental Mutation 'R7957:Cebpa'
ID649888
Institutional Source Beutler Lab
Gene Symbol Cebpa
Ensembl Gene ENSMUSG00000034957
Gene NameCCAAT/enhancer binding protein (C/EBP), alpha
SynonymsCebp, C/ebpalpha, C/EBP alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35119293-35121928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35120442 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 342 (I342V)
Ref Sequence ENSEMBL: ENSMUSP00000096129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042985] [ENSMUST00000205391]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042985
AA Change: I342V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096129
Gene: ENSMUSG00000034957
AA Change: I342V

DomainStartEndE-ValueType
low complexity region 29 54 N/A INTRINSIC
low complexity region 91 135 N/A INTRINSIC
low complexity region 181 201 N/A INTRINSIC
low complexity region 218 255 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
BRLZ 281 345 3.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. The use of alternative in-frame non-AUG (CUG) and AUG start codons results in several protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the CUG and the first AUG start codons. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the liver, neutrophils, lung, and brown fat, resulting in impaired glycogen storage and lipid accumulation, hypoglycemia, reduced uncoupling protein, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Cebpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0529:Cebpa UTSW 7 35120199 missense probably benign
R2061:Cebpa UTSW 7 35119522 missense probably damaging 0.96
R2211:Cebpa UTSW 7 35120466 missense probably damaging 1.00
R4638:Cebpa UTSW 7 35120262 missense probably damaging 0.97
R4869:Cebpa UTSW 7 35119821 missense probably damaging 0.97
R5269:Cebpa UTSW 7 35119858 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCAACGAGTACCGGGTAC -3'
(R):5'- TCTTAGACGCACCGAGTCCG -3'

Sequencing Primer
(F):5'- TGGAGTTGACCAGTGACA -3'
(R):5'- AGCAGGCCAGGCTTTCAG -3'
Posted On2020-09-15