Incidental Mutation 'R7957:Zfp473'
ID 649889
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Name zinc finger protein 473
Synonyms D030014N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R7957 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44731480-44751050 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44732492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 806 (E806K)
Ref Sequence ENSEMBL: ENSMUSP00000051069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
AlphaFold Q8BI67
Predicted Effect probably damaging
Transcript: ENSMUST00000060270
AA Change: E806K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: E806K

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118162
AA Change: E805K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: E805K

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120074
AA Change: E806K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: E806K

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120798
AA Change: E805K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: E805K

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44734568 missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44733727 missense probably benign 0.00
IGL02027:Zfp473 APN 7 44738038 splice site probably benign
IGL02314:Zfp473 APN 7 44733929 missense probably benign 0.00
IGL02445:Zfp473 APN 7 44733683 missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44733098 missense probably benign 0.05
R0037:Zfp473 UTSW 7 44733900 missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44733188 missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44734594 missense probably benign 0.00
R1387:Zfp473 UTSW 7 44732941 missense probably benign 0.00
R2141:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44732252 missense probably benign 0.08
R4453:Zfp473 UTSW 7 44733254 missense probably damaging 0.99
R4585:Zfp473 UTSW 7 44732952 nonsense probably null
R4586:Zfp473 UTSW 7 44732952 nonsense probably null
R4945:Zfp473 UTSW 7 44734564 missense probably benign 0.00
R5072:Zfp473 UTSW 7 44732519 missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44732848 missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44732638 missense probably damaging 1.00
R5551:Zfp473 UTSW 7 44734151 missense probably benign 0.03
R5618:Zfp473 UTSW 7 44741732 missense probably benign 0.08
R5985:Zfp473 UTSW 7 44733328 missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44733534 missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44732794 missense possibly damaging 0.58
R7069:Zfp473 UTSW 7 44732374 missense probably damaging 1.00
R7284:Zfp473 UTSW 7 44733203 missense not run
R7361:Zfp473 UTSW 7 44733139 missense probably damaging 1.00
R7495:Zfp473 UTSW 7 44737944 missense probably benign 0.04
R7631:Zfp473 UTSW 7 44733704 missense possibly damaging 0.62
R7940:Zfp473 UTSW 7 44734576 missense probably damaging 1.00
R8480:Zfp473 UTSW 7 44732899 missense probably damaging 1.00
R9464:Zfp473 UTSW 7 44734342 missense probably benign 0.00
R9569:Zfp473 UTSW 7 44739547 missense probably damaging 1.00
X0027:Zfp473 UTSW 7 44733418 missense probably damaging 1.00
Z1177:Zfp473 UTSW 7 44732308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGAACTCTATGGTTTGGCC -3'
(R):5'- AACAGGGCCTTCAAACAGCG -3'

Sequencing Primer
(F):5'- GAAGGCCTTCCCACACAG -3'
(R):5'- TGTGACAGAGCCTTCAAGC -3'
Posted On 2020-09-15