Incidental Mutation 'R7957:Nipa1'
ID649890
Institutional Source Beutler Lab
Gene Symbol Nipa1
Ensembl Gene ENSMUSG00000047037
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Synonyms1110027G09Rik, Spg6, A830014A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7957 (G1)
Quality Score202.009
Status Validated
Chromosome7
Chromosomal Location55977567-56019954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55979799 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 189 (C189S)
Ref Sequence ENSEMBL: ENSMUSP00000053871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052204]
Predicted Effect probably damaging
Transcript: ENSMUST00000052204
AA Change: C189S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053871
Gene: ENSMUSG00000047037
AA Change: C189S

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 21 308 1.6e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium transporter that associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells. This protein may play a role in nervous system development and maintenance. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with autosomal dominant spastic paraplegia 6. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Nipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Nipa1 APN 7 55979661 missense probably benign 0.20
impressionless UTSW 7 55979606 missense probably benign 0.04
untouched UTSW 7 55979823 missense probably damaging 1.00
R2116:Nipa1 UTSW 7 55985525 missense possibly damaging 0.69
R2141:Nipa1 UTSW 7 55997511 splice site probably null
R2142:Nipa1 UTSW 7 55997511 splice site probably null
R4823:Nipa1 UTSW 7 55979688 missense possibly damaging 0.71
R5424:Nipa1 UTSW 7 55979475 missense possibly damaging 0.90
R5463:Nipa1 UTSW 7 55979457 nonsense probably null
R6459:Nipa1 UTSW 7 55979606 missense probably benign 0.04
R6468:Nipa1 UTSW 7 56019504 missense probably benign 0.39
R6615:Nipa1 UTSW 7 55979823 missense probably damaging 1.00
R7662:Nipa1 UTSW 7 55979624 missense probably damaging 0.98
R7921:Nipa1 UTSW 7 55979810 missense probably damaging 1.00
R8445:Nipa1 UTSW 7 55979718 missense probably benign 0.03
X0064:Nipa1 UTSW 7 55979759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACACAACGTAGTAGATGGCCC -3'
(R):5'- GGTTCAGCTCTGACCTCTTGATG -3'

Sequencing Primer
(F):5'- CGTAGTAGATGGCCCCAAATACAG -3'
(R):5'- AGCTCTGACCTCTTGATGGTGTTTG -3'
Posted On2020-09-15