Mutagenetix > Incidental Mutations

Incidental Mutation 'R7957:Myo9b'

649894

Institutional Source

Beutler Lab

Gene Symbol

Myo9b

Ensembl Gene

ENSMUSG00000004677

Gene Name

myosin IXb

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R7957 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71272714-71360713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71354761 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1614 (I1614F)

Ref Sequence

ENSEMBL: ENSMUSP00000129220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]

Predicted Effect

probably benign
Transcript: ENSMUST00000071935
AA Change: I1600F

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: I1600F

Domain	Start	End	E-Value	Type
RA	15	114	3.7e-30	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	1.2e-3	SMART
IQ	978	1000	1.6e-5	SMART
IQ	1001	1022	4.3e-5	SMART
IQ	1023	1045	8.4e-5	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1232	1246	N/A	INTRINSIC
Blast:MYSc	1247	1323	3e-19	BLAST
low complexity region	1348	1359	N/A	INTRINSIC
coiled coil region	1563	1590	N/A	INTRINSIC
C1	1591	1639	1.7e-14	SMART
RhoGAP	1668	1843	4.7e-71	SMART
coiled coil region	1901	1925	N/A	INTRINSIC
low complexity region	1940	1952	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168839
AA Change: I1614F

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: I1614F

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1915	1939	N/A	INTRINSIC
low complexity region	1954	1966	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170242
AA Change: I1614F

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: I1614F

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1931	1955	N/A	INTRINSIC
low complexity region	1970	1982	N/A	INTRINSIC
low complexity region	1992	2003	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212935
AA Change: I1602F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.2355

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 110,091,613	M1T	probably null	Het
Abhd2	T	A	7: 79,325,446	M128K	probably benign	Het
Adamts12	A	G	15: 11,317,212	T1333A	possibly damaging	Het
Alg8	A	G	7: 97,390,924	T438A	probably benign	Het
Cebpa	A	G	7: 35,120,442	I342V	possibly damaging	Het
Chd9	T	C	8: 91,051,698	M2779T	probably damaging	Het
Cnot3	C	A	7: 3,658,222	P577T	probably benign	Het
Col17a1	T	C	19: 47,661,117	D755G	probably damaging	Het
Col5a3	A	G	9: 20,774,051	V1443A	unknown	Het
Crygs	C	T	16: 22,805,332	R175H	probably damaging	Het
Fam193a	A	G	5: 34,462,086	D1031G	probably damaging	Het
Fam83b	T	A	9: 76,491,985	H612L	probably benign	Het
Gabrr2	A	G	4: 33,081,410	T149A	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm3667	T	C	14: 6,872,332	N156D	probably benign	Het
Hpcal1	T	A	12: 17,791,170	L183Q	probably damaging	Het
Ilf2	G	T	3: 90,487,470	E342*	probably null	Het
Ints13	A	G	6: 146,550,766	S652P	probably damaging	Het
Kansl2	C	A	15: 98,524,618	E356D	probably benign	Het
Klhl6	T	C	16: 19,949,451	E448G	probably null	Het
Mmp14	A	G	14: 54,436,250	I124V	probably benign	Het
Morc2b	A	T	17: 33,135,773	D1008E	probably benign	Het
Muc16	A	C	9: 18,643,471	V3842G	unknown	Het
Nipa1	A	T	7: 55,979,799	C189S	probably damaging	Het
Nov	G	T	15: 54,746,338	S78I	possibly damaging	Het
Ntn4	T	C	10: 93,644,473		probably benign	Het
Olfr1274-ps	A	T	2: 90,401,051	Y130F	probably damaging	Het
Olfr146	T	G	9: 39,019,053	I163L	probably benign	Het
Olfr329-ps	A	G	11: 58,542,798	L239P	probably damaging	Het
Olfr358	A	G	2: 37,004,960	I218T	probably benign	Het
Olfr399	A	C	11: 74,054,156	L201R	probably damaging	Het
Pank1	T	A	19: 34,813,696	H528L	probably damaging	Het
Pappa2	A	T	1: 158,761,561	L1698*	probably null	Het
Park7	A	G	4: 150,903,884	S85P	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Rapgef2	T	C	3: 79,214,969	E30G	probably benign	Het
Rhbdf1	A	G	11: 32,210,523	F676L	probably damaging	Het
Rsf1	GGC	GGCCACGGCAGC	7: 97,579,906		probably benign	Het
Scd4	G	T	19: 44,341,248	M219I	probably benign	Het
Slfn5	T	A	11: 82,956,787	I166N	probably benign	Het
Smim22	A	T	16: 5,008,225	D85V	probably damaging	Het
Socs2	T	C	10: 95,414,950	E7G	probably benign	Het
Thumpd2	T	C	17: 81,026,728	E477G	probably benign	Het
Tlr12	C	T	4: 128,616,690	G589D	probably benign	Het
Ttn	A	T	2: 76,764,855	I20317K	probably damaging	Het
Ttyh2	A	G	11: 114,708,864		probably null	Het
Ugt2a3	T	A	5: 87,327,191	D398V	probably damaging	Het
Vmn2r88	A	T	14: 51,413,132	M101L		Het
Vmn2r93	A	T	17: 18,325,692	R609*	probably null	Het
Zfp473	C	T	7: 44,732,492	E806K	probably damaging	Het
Zfp93	T	C	7: 24,275,574	L328P	probably damaging	Het

Other mutations in Myo9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Myo9b	APN	8	71348735	missense	probably benign
IGL01020:Myo9b	APN	8	71352000	missense	probably benign
IGL01479:Myo9b	APN	8	71359342	missense	probably damaging	1.00
IGL01704:Myo9b	APN	8	71359642	missense	probably damaging	0.98
IGL01761:Myo9b	APN	8	71349152	missense	probably damaging	0.96
IGL01766:Myo9b	APN	8	71290517	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71356318	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71355257	missense	possibly damaging	0.93
IGL01838:Myo9b	APN	8	71334390	missense	probably damaging	0.99
IGL02318:Myo9b	APN	8	71354124	missense	probably damaging	0.98
IGL02333:Myo9b	APN	8	71358993	missense	possibly damaging	0.65
IGL02340:Myo9b	APN	8	71291045	missense	probably damaging	1.00
IGL02514:Myo9b	APN	8	71291006	missense	probably damaging	1.00
IGL02593:Myo9b	APN	8	71290773	missense	probably damaging	1.00
IGL03075:Myo9b	APN	8	71354527	missense	probably damaging	1.00
IGL03332:Myo9b	APN	8	71348774	missense	possibly damaging	0.78
avantgarde	UTSW	8	71344162	missense	probably damaging	1.00
Freaky	UTSW	8	71290819	missense	probably damaging	1.00
iconoclastic	UTSW	8	71290475	missense	probably benign	0.37
unconventional	UTSW	8	71348597	missense	probably benign	0.00
PIT4418001:Myo9b	UTSW	8	71322947	missense	probably damaging	1.00
PIT4651001:Myo9b	UTSW	8	71342812	missense	possibly damaging	0.83
R0023:Myo9b	UTSW	8	71333768	missense	probably damaging	1.00
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0144:Myo9b	UTSW	8	71346043	missense	probably damaging	1.00
R0207:Myo9b	UTSW	8	71355225	splice site	probably benign
R0226:Myo9b	UTSW	8	71353832	missense	probably damaging	1.00
R0227:Myo9b	UTSW	8	71344162	missense	probably damaging	1.00
R0244:Myo9b	UTSW	8	71321813	missense	probably damaging	1.00
R0277:Myo9b	UTSW	8	71355952	splice site	probably benign
R0362:Myo9b	UTSW	8	71347770	missense	probably damaging	1.00
R0689:Myo9b	UTSW	8	71330756	missense	probably damaging	1.00
R0844:Myo9b	UTSW	8	71290475	missense	probably benign	0.37
R1051:Myo9b	UTSW	8	71355822	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1526:Myo9b	UTSW	8	71355764	missense	probably damaging	1.00
R1544:Myo9b	UTSW	8	71290976	missense	probably damaging	1.00
R1565:Myo9b	UTSW	8	71315192	missense	possibly damaging	0.46
R1645:Myo9b	UTSW	8	71322978	missense	probably damaging	1.00
R1745:Myo9b	UTSW	8	71354047	missense	probably damaging	1.00
R1820:Myo9b	UTSW	8	71333358	missense	probably damaging	1.00
R2037:Myo9b	UTSW	8	71290866	missense	probably damaging	1.00
R2050:Myo9b	UTSW	8	71290550	missense	probably damaging	1.00
R2056:Myo9b	UTSW	8	71359690	missense	possibly damaging	0.78
R2129:Myo9b	UTSW	8	71333699	missense	probably damaging	1.00
R2423:Myo9b	UTSW	8	71327940	missense	probably damaging	1.00
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2873:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2874:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2920:Myo9b	UTSW	8	71325857	missense	probably damaging	0.98
R2926:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2939:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2940:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3033:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3040:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3689:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3691:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3735:Myo9b	UTSW	8	71348597	missense	probably benign	0.00
R4194:Myo9b	UTSW	8	71359624	missense	possibly damaging	0.71
R4258:Myo9b	UTSW	8	71355765	missense	probably damaging	1.00
R4457:Myo9b	UTSW	8	71290999	missense	probably damaging	1.00
R4478:Myo9b	UTSW	8	71291081	missense	probably damaging	1.00
R4496:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R4544:Myo9b	UTSW	8	71327941	missense	probably damaging	1.00
R4580:Myo9b	UTSW	8	71315135	missense	probably damaging	1.00
R4736:Myo9b	UTSW	8	71356592	missense	probably damaging	1.00
R5068:Myo9b	UTSW	8	71349055	missense	probably damaging	1.00
R5124:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R5194:Myo9b	UTSW	8	71349089	missense	probably benign	0.01
R5296:Myo9b	UTSW	8	71333388	missense	possibly damaging	0.69
R5528:Myo9b	UTSW	8	71323274	missense	probably benign	0.06
R5664:Myo9b	UTSW	8	71359882	missense	probably benign	0.13
R5677:Myo9b	UTSW	8	71343686	missense	probably damaging	1.00
R5680:Myo9b	UTSW	8	71290372	missense	probably benign	0.00
R5982:Myo9b	UTSW	8	71348396	missense	probably benign	0.05
R6344:Myo9b	UTSW	8	71327914	missense	probably damaging	1.00
R6352:Myo9b	UTSW	8	71348410	missense	probably benign	0.16
R6352:Myo9b	UTSW	8	71348411	missense	probably benign
R6411:Myo9b	UTSW	8	71322955	nonsense	probably null
R6425:Myo9b	UTSW	8	71333628	missense	probably damaging	1.00
R6505:Myo9b	UTSW	8	71355857	missense	possibly damaging	0.88
R6743:Myo9b	UTSW	8	71352159	splice site	probably null
R6811:Myo9b	UTSW	8	71356578	missense	probably damaging	1.00
R6813:Myo9b	UTSW	8	71323305	missense	probably damaging	1.00
R6954:Myo9b	UTSW	8	71290819	missense	probably damaging	1.00
R7124:Myo9b	UTSW	8	71333701	nonsense	probably null
R7255:Myo9b	UTSW	8	71290891	missense	probably damaging	1.00
R7293:Myo9b	UTSW	8	71325905	missense	probably benign	0.00
R7342:Myo9b	UTSW	8	71355774	missense	probably damaging	1.00
R7451:Myo9b	UTSW	8	71352188	missense	probably benign	0.28
R7482:Myo9b	UTSW	8	71342798	missense	probably benign	0.00
R7508:Myo9b	UTSW	8	71354801	missense	probably benign	0.00
R8062:Myo9b	UTSW	8	71321813	missense	probably damaging	0.99
R8108:Myo9b	UTSW	8	71348342	missense	probably damaging	0.99
R8197:Myo9b	UTSW	8	71290963	missense	probably damaging	1.00
R8274:Myo9b	UTSW	8	71359836	missense	probably benign	0.00
R8686:Myo9b	UTSW	8	71334322	missense	probably benign	0.01
R8731:Myo9b	UTSW	8	71353842	critical splice donor site	probably null
X0066:Myo9b	UTSW	8	71323898	missense	probably damaging	1.00
Z1177:Myo9b	UTSW	8	71290709	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTGTCCCCACACTGACTTG -3'
(R):5'- ACATCATCTGCCTTTGTGATTGTG -3'

Sequencing Primer
(F):5'- TCTCTGTCTCTCAGCAGAGCAAAG -3'
(R):5'- CCTTTGTGATTGTGTGTGCAAG -3'

Posted On

2020-09-15