Mutagenetix > Incidental Mutation

Incidental Mutation 'R7957:Chd9'

649895

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik

MMRRC Submission

046001-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7957 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91554980-91781144 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91778326 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 2779 (M2779T)

Ref Sequence

ENSEMBL: ENSMUSP00000046356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048665
AA Change: M2779T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: M2779T

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109614
AA Change: M2795T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: M2795T

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209203

Predicted Effect

probably damaging
Transcript: ENSMUST00000209423
AA Change: M2795T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.2338

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 109,982,439 (GRCm39)	M1T	probably null	Het
Abhd2	T	A	7: 78,975,194 (GRCm39)	M128K	probably benign	Het
Adamts12	A	G	15: 11,317,298 (GRCm39)	T1333A	possibly damaging	Het
Alg8	A	G	7: 97,040,131 (GRCm39)	T438A	probably benign	Het
Ccn3	G	T	15: 54,609,734 (GRCm39)	S78I	possibly damaging	Het
Cebpa	A	G	7: 34,819,867 (GRCm39)	I342V	possibly damaging	Het
Cnot3	C	A	7: 3,661,221 (GRCm39)	P577T	probably benign	Het
Col17a1	T	C	19: 47,649,556 (GRCm39)	D755G	probably damaging	Het
Col5a3	A	G	9: 20,685,347 (GRCm39)	V1443A	unknown	Het
Crygs	C	T	16: 22,624,082 (GRCm39)	R175H	probably damaging	Het
Fam193a	A	G	5: 34,619,430 (GRCm39)	D1031G	probably damaging	Het
Fam83b	T	A	9: 76,399,267 (GRCm39)	H612L	probably benign	Het
Gabrr2	A	G	4: 33,081,410 (GRCm39)	T149A	probably damaging	Het
Gm3667	T	C	14: 18,269,663 (GRCm39)	N156D	probably benign	Het
Hpcal1	T	A	12: 17,841,171 (GRCm39)	L183Q	probably damaging	Het
Ilf2	G	T	3: 90,394,777 (GRCm39)	E342*	probably null	Het
Ints13	A	G	6: 146,452,264 (GRCm39)	S652P	probably damaging	Het
Kansl2	C	A	15: 98,422,499 (GRCm39)	E356D	probably benign	Het
Klhl6	T	C	16: 19,768,201 (GRCm39)	E448G	probably null	Het
Mmp14	A	G	14: 54,673,707 (GRCm39)	I124V	probably benign	Het
Morc2b	A	T	17: 33,354,747 (GRCm39)	D1008E	probably benign	Het
Muc16	A	C	9: 18,554,767 (GRCm39)	V3842G	unknown	Het
Myo9b	A	T	8: 71,807,405 (GRCm39)	I1614F	probably benign	Het
Nipa1	A	T	7: 55,629,547 (GRCm39)	C189S	probably damaging	Het
Ntn4	T	C	10: 93,480,335 (GRCm39)		probably benign	Het
Or12k5	A	G	2: 36,894,972 (GRCm39)	I218T	probably benign	Het
Or2t29	A	G	11: 58,433,624 (GRCm39)	L239P	probably damaging	Het
Or3a4	A	C	11: 73,944,982 (GRCm39)	L201R	probably damaging	Het
Or4x13	A	T	2: 90,231,395 (GRCm39)	Y130F	probably damaging	Het
Or8g17	T	G	9: 38,930,349 (GRCm39)	I163L	probably benign	Het
Pank1	T	A	19: 34,791,096 (GRCm39)	H528L	probably damaging	Het
Pappa2	A	T	1: 158,589,131 (GRCm39)	L1698*	probably null	Het
Park7	A	G	4: 150,988,341 (GRCm39)	S85P	probably damaging	Het
Pik3r4	A	G	9: 105,564,408 (GRCm39)	D1334G	probably damaging	Het
Pira1	C	G	7: 3,740,319 (GRCm39)	A301P	probably damaging	Het
Rapgef2	T	C	3: 79,122,276 (GRCm39)	E30G	probably benign	Het
Rhbdf1	A	G	11: 32,160,523 (GRCm39)	F676L	probably damaging	Het
Rsf1	GGC	GGCCACGGCAGC	7: 97,229,113 (GRCm39)		probably benign	Het
Scd4	G	T	19: 44,329,687 (GRCm39)	M219I	probably benign	Het
Slfn5	T	A	11: 82,847,613 (GRCm39)	I166N	probably benign	Het
Smim22	A	T	16: 4,826,089 (GRCm39)	D85V	probably damaging	Het
Socs2	T	C	10: 95,250,812 (GRCm39)	E7G	probably benign	Het
Thumpd2	T	C	17: 81,334,157 (GRCm39)	E477G	probably benign	Het
Tlr12	C	T	4: 128,510,483 (GRCm39)	G589D	probably benign	Het
Ttn	A	T	2: 76,595,199 (GRCm39)	I20317K	probably damaging	Het
Ttyh2	A	G	11: 114,599,690 (GRCm39)		probably null	Het
Ugt2a3	T	A	5: 87,475,050 (GRCm39)	D398V	probably damaging	Het
Vmn2r88	A	T	14: 51,650,589 (GRCm39)	M101L		Het
Vmn2r93	A	T	17: 18,545,954 (GRCm39)	R609*	probably null	Het
Zfp473	C	T	7: 44,381,916 (GRCm39)	E806K	probably damaging	Het
Zfp93	T	C	7: 23,974,999 (GRCm39)	L328P	probably damaging	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91,752,020 (GRCm39)	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91,732,426 (GRCm39)	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91,742,474 (GRCm39)	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	91,712,760 (GRCm39)	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	91,710,118 (GRCm39)	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	91,699,835 (GRCm39)	missense	probably benign	0.29
IGL00908:Chd9	APN	8	91,723,508 (GRCm39)	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91,778,320 (GRCm39)	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91,768,744 (GRCm39)	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91,753,404 (GRCm39)	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	91,660,395 (GRCm39)	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91,760,138 (GRCm39)	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	91,659,116 (GRCm39)	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	91,683,122 (GRCm39)	nonsense	probably null
IGL02164:Chd9	APN	8	91,659,849 (GRCm39)	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91,778,312 (GRCm39)	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91,760,210 (GRCm39)	missense	probably benign	0.33
IGL02892:Chd9	APN	8	91,703,543 (GRCm39)	splice site	probably benign
IGL02897:Chd9	APN	8	91,660,496 (GRCm39)	splice site	probably benign
IGL03005:Chd9	APN	8	91,738,075 (GRCm39)	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91,741,895 (GRCm39)	splice site	probably benign
IGL03140:Chd9	APN	8	91,768,856 (GRCm39)	missense	possibly damaging	0.91
hovel	UTSW	8	91,741,832 (GRCm39)	missense	probably benign	0.19
shack	UTSW	8	91,659,426 (GRCm39)	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	91,660,165 (GRCm39)	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91,735,464 (GRCm39)	splice site	probably null
R0238:Chd9	UTSW	8	91,659,456 (GRCm39)	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	91,659,456 (GRCm39)	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	91,721,078 (GRCm39)	splice site	probably benign
R0454:Chd9	UTSW	8	91,699,859 (GRCm39)	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	91,725,223 (GRCm39)	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	91,721,191 (GRCm39)	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91,763,170 (GRCm39)	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	91,704,304 (GRCm39)	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91,777,825 (GRCm39)	missense	probably benign	0.06
R0945:Chd9	UTSW	8	91,659,630 (GRCm39)	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91,741,832 (GRCm39)	missense	probably benign	0.19
R0967:Chd9	UTSW	8	91,716,107 (GRCm39)	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	91,659,206 (GRCm39)	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	91,712,764 (GRCm39)	nonsense	probably null
R1244:Chd9	UTSW	8	91,749,557 (GRCm39)	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91,733,123 (GRCm39)	splice site	probably null
R1570:Chd9	UTSW	8	91,763,170 (GRCm39)	missense	probably benign	0.03
R1591:Chd9	UTSW	8	91,710,166 (GRCm39)	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	91,725,163 (GRCm39)	missense	probably benign	0.17
R1626:Chd9	UTSW	8	91,721,224 (GRCm39)	missense	probably benign	0.00
R1632:Chd9	UTSW	8	91,683,335 (GRCm39)	nonsense	probably null
R1649:Chd9	UTSW	8	91,659,229 (GRCm39)	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91,749,418 (GRCm39)	splice site	probably null
R1668:Chd9	UTSW	8	91,767,814 (GRCm39)	missense	probably damaging	0.99
R1681:Chd9	UTSW	8	91,699,763 (GRCm39)	missense	probably damaging	0.98
R1695:Chd9	UTSW	8	91,728,410 (GRCm39)	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91,760,853 (GRCm39)	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91,737,326 (GRCm39)	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91,737,422 (GRCm39)	missense	probably benign	0.19
R1844:Chd9	UTSW	8	91,683,323 (GRCm39)	nonsense	probably null
R1941:Chd9	UTSW	8	91,703,697 (GRCm39)	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91,761,682 (GRCm39)	missense	probably benign	0.17
R2027:Chd9	UTSW	8	91,634,619 (GRCm39)	unclassified	probably benign
R2098:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91,737,913 (GRCm39)	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91,777,756 (GRCm39)	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91,760,615 (GRCm39)	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91,757,088 (GRCm39)	splice site	probably null
R3418:Chd9	UTSW	8	91,763,219 (GRCm39)	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	91,710,893 (GRCm39)	splice site	probably benign
R3923:Chd9	UTSW	8	91,660,147 (GRCm39)	missense	probably benign	0.16
R4001:Chd9	UTSW	8	91,683,185 (GRCm39)	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	91,683,185 (GRCm39)	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	91,660,188 (GRCm39)	missense	probably benign	0.12
R4013:Chd9	UTSW	8	91,699,797 (GRCm39)	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91,750,202 (GRCm39)	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91,737,304 (GRCm39)	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91,777,912 (GRCm39)	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91,777,912 (GRCm39)	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	91,704,308 (GRCm39)	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	91,705,627 (GRCm39)	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91,760,659 (GRCm39)	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91,763,134 (GRCm39)	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	91,710,091 (GRCm39)	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91,760,428 (GRCm39)	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91,741,877 (GRCm39)	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91,760,858 (GRCm39)	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91,760,336 (GRCm39)	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91,733,254 (GRCm39)	nonsense	probably null
R5083:Chd9	UTSW	8	91,711,002 (GRCm39)	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	91,704,147 (GRCm39)	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91,753,462 (GRCm39)	nonsense	probably null
R5307:Chd9	UTSW	8	91,723,777 (GRCm39)	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91,778,132 (GRCm39)	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91,742,553 (GRCm39)	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91,738,078 (GRCm39)	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91,763,190 (GRCm39)	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91,728,384 (GRCm39)	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	91,716,078 (GRCm39)	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	91,723,792 (GRCm39)	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91,778,464 (GRCm39)	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	91,705,515 (GRCm39)	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91,761,691 (GRCm39)	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91,775,765 (GRCm39)	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	91,659,045 (GRCm39)	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	91,659,550 (GRCm39)	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91,757,174 (GRCm39)	missense	possibly damaging	0.93
R6348:Chd9	UTSW	8	91,737,903 (GRCm39)	missense	possibly damaging	0.95
R6438:Chd9	UTSW	8	91,725,149 (GRCm39)	missense	probably benign	0.02
R6470:Chd9	UTSW	8	91,659,426 (GRCm39)	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91,778,182 (GRCm39)	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91,769,579 (GRCm39)	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	91,683,044 (GRCm39)	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91,769,573 (GRCm39)	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	91,705,542 (GRCm39)	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91,760,843 (GRCm39)	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	91,716,189 (GRCm39)	missense	unknown
R7126:Chd9	UTSW	8	91,741,853 (GRCm39)	missense	unknown
R7182:Chd9	UTSW	8	91,733,250 (GRCm39)	missense	unknown
R7219:Chd9	UTSW	8	91,728,394 (GRCm39)	missense	unknown
R7260:Chd9	UTSW	8	91,721,171 (GRCm39)	missense	unknown
R7293:Chd9	UTSW	8	91,760,707 (GRCm39)	missense	unknown
R7303:Chd9	UTSW	8	91,778,532 (GRCm39)	missense	unknown
R7358:Chd9	UTSW	8	91,760,846 (GRCm39)	missense	unknown
R7358:Chd9	UTSW	8	91,710,115 (GRCm39)	missense	unknown
R7451:Chd9	UTSW	8	91,760,446 (GRCm39)	missense	probably benign	0.27
R7451:Chd9	UTSW	8	91,760,418 (GRCm39)	frame shift	probably null
R7456:Chd9	UTSW	8	91,659,153 (GRCm39)	nonsense	probably null
R7481:Chd9	UTSW	8	91,683,066 (GRCm39)	missense	unknown
R7532:Chd9	UTSW	8	91,721,193 (GRCm39)	missense	unknown
R7570:Chd9	UTSW	8	91,721,208 (GRCm39)	missense	unknown
R7611:Chd9	UTSW	8	91,763,017 (GRCm39)	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91,778,325 (GRCm39)	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91,741,837 (GRCm39)	missense	unknown
R7739:Chd9	UTSW	8	91,761,653 (GRCm39)	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	91,704,178 (GRCm39)	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91,761,684 (GRCm39)	nonsense	probably null
R7921:Chd9	UTSW	8	91,768,909 (GRCm39)	critical splice donor site	probably null
R7972:Chd9	UTSW	8	91,732,395 (GRCm39)	missense	unknown
R8108:Chd9	UTSW	8	91,659,852 (GRCm39)	missense	unknown
R8115:Chd9	UTSW	8	91,762,960 (GRCm39)	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91,767,769 (GRCm39)	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91,752,015 (GRCm39)	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	91,725,233 (GRCm39)	missense	unknown
R8208:Chd9	UTSW	8	91,763,891 (GRCm39)	splice site	probably null
R8256:Chd9	UTSW	8	91,660,129 (GRCm39)	missense	unknown
R8281:Chd9	UTSW	8	91,763,225 (GRCm39)	missense	probably damaging	1.00
R8504:Chd9	UTSW	8	91,723,472 (GRCm39)	missense	unknown
R8836:Chd9	UTSW	8	91,767,812 (GRCm39)	missense	probably damaging	0.99
R8892:Chd9	UTSW	8	91,660,468 (GRCm39)	missense	unknown
R8985:Chd9	UTSW	8	91,721,101 (GRCm39)	missense	unknown
R9029:Chd9	UTSW	8	91,683,198 (GRCm39)	missense	unknown
R9030:Chd9	UTSW	8	91,683,198 (GRCm39)	missense	unknown
R9038:Chd9	UTSW	8	91,716,233 (GRCm39)	missense	unknown
R9081:Chd9	UTSW	8	91,704,144 (GRCm39)	nonsense	probably null
R9134:Chd9	UTSW	8	91,659,754 (GRCm39)	missense	unknown
R9205:Chd9	UTSW	8	91,757,270 (GRCm39)	missense	probably benign	0.01
R9309:Chd9	UTSW	8	91,733,319 (GRCm39)	missense	unknown
R9375:Chd9	UTSW	8	91,725,335 (GRCm39)	critical splice donor site	probably null
R9449:Chd9	UTSW	8	91,659,174 (GRCm39)	missense	unknown
R9547:Chd9	UTSW	8	91,683,186 (GRCm39)	missense	unknown
R9573:Chd9	UTSW	8	91,704,302 (GRCm39)	missense	unknown
R9576:Chd9	UTSW	8	91,659,294 (GRCm39)	missense	unknown
R9601:Chd9	UTSW	8	91,732,360 (GRCm39)	nonsense	probably null
R9613:Chd9	UTSW	8	91,683,150 (GRCm39)	nonsense	probably null
R9639:Chd9	UTSW	8	91,760,840 (GRCm39)	missense	probably null
R9718:Chd9	UTSW	8	91,712,801 (GRCm39)	missense	unknown
R9746:Chd9	UTSW	8	91,738,063 (GRCm39)	missense	unknown
R9762:Chd9	UTSW	8	91,712,741 (GRCm39)	missense	unknown
R9764:Chd9	UTSW	8	91,721,220 (GRCm39)	missense	unknown
R9790:Chd9	UTSW	8	91,760,417 (GRCm39)	missense	possibly damaging	0.82
R9791:Chd9	UTSW	8	91,760,417 (GRCm39)	missense	possibly damaging	0.82
RF007:Chd9	UTSW	8	91,760,578 (GRCm39)	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91,763,200 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGTCAAAGACTGCAGAG -3'
(R):5'- TGAGAGGACTAGGCTCAGTTCC -3'

Sequencing Primer
(F):5'- ACTGCAGAGTCTGGGGC -3'
(R):5'- GACTAGGCTCAGTTCCCCCTTTC -3'

Posted On

2020-09-15