Incidental Mutation 'R7957:Socs2'
List |< first << previous [record 43 of 52] next >> last >|
ID649902
Institutional Source Beutler Lab
Gene Symbol Socs2
Ensembl Gene ENSMUSG00000020027
Gene Namesuppressor of cytokine signaling 2
SynonymsCIS2, D130043N08Rik, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, Cish2, SOCS-2, JAB, SSI-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location95385362-95417180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95414950 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 7 (E7G)
Ref Sequence ENSEMBL: ENSMUSP00000020215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020215] [ENSMUST00000119917] [ENSMUST00000129942] [ENSMUST00000135822] [ENSMUST00000150432] [ENSMUST00000170690] [ENSMUST00000172070]
Predicted Effect probably benign
Transcript: ENSMUST00000020215
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020215
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119917
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113378
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129942
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117576
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
SCOP:d1a81a2 30 62 8e-4 SMART
PDB:4JGH|A 45 62 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135822
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118720
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:SH2 48 80 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139210
SMART Domains Protein: ENSMUSP00000121305
Gene: ENSMUSG00000020027

DomainStartEndE-ValueType
SH2 1 89 5.07e-20 SMART
SOCS 108 149 3.15e-16 SMART
SOCS_box 114 148 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150432
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117785
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
SCOP:d1bg1a3 40 70 3e-7 SMART
PDB:2C9W|A 45 70 5e-12 PDB
Blast:SH2 46 70 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170690
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129331
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172070
AA Change: E7G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131875
Gene: ENSMUSG00000020027
AA Change: E7G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutations in this gene cause accelerated postnatal growth. Homozygotes for a targeted mutation also show increased bone growth, enlargement of most organs, collagen deposition in the skin and some ducts and vessels, lower major urinary protein levels, and elevated IGF-I mRNA levels in some tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Socs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03064:Socs2 APN 10 95412851 nonsense probably null
samson UTSW 10 95413081 nonsense probably null
R1412:Socs2 UTSW 10 95414918 missense probably benign
R1617:Socs2 UTSW 10 95413081 nonsense probably null
R1921:Socs2 UTSW 10 95413038 nonsense probably null
R5261:Socs2 UTSW 10 95392819 missense unknown
R5638:Socs2 UTSW 10 95392883 missense unknown
R7689:Socs2 UTSW 10 95414983 start gained probably benign
R8744:Socs2 UTSW 10 95392800 missense
Predicted Primers PCR Primer
(F):5'- AGTTCCATCGCTTTCAGTGC -3'
(R):5'- ACCATTCTGCCGGAATTTGG -3'

Sequencing Primer
(F):5'- TTCAGTGCCCCCAACCTGG -3'
(R):5'- CATTCTGCCGGAATTTGGAGAAAAAG -3'
Posted On2020-09-15