Incidental Mutation 'R7957:Or2t29'
ID 649904
Institutional Source Beutler Lab
Gene Symbol Or2t29
Ensembl Gene ENSMUSG00000064252
Gene Name olfactory receptor family 2 subfamily T member 29
Synonyms GA_x6K02T2NKPP-882068-883006, Olfr329-ps, MOR275-6P, Olfr329
MMRRC Submission 046001-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7957 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 58433273-58434309 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58433624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 239 (L239P)
Ref Sequence ENSEMBL: ENSMUSP00000104450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108822] [ENSMUST00000108823] [ENSMUST00000219448]
AlphaFold M9MMK4
Predicted Effect probably damaging
Transcript: ENSMUST00000108822
AA Change: L239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: L239P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108823
AA Change: L226P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104451
Gene: ENSMUSG00000064252
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219448
AA Change: L226P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,982,439 (GRCm39) M1T probably null Het
Abhd2 T A 7: 78,975,194 (GRCm39) M128K probably benign Het
Adamts12 A G 15: 11,317,298 (GRCm39) T1333A possibly damaging Het
Alg8 A G 7: 97,040,131 (GRCm39) T438A probably benign Het
Ccn3 G T 15: 54,609,734 (GRCm39) S78I possibly damaging Het
Cebpa A G 7: 34,819,867 (GRCm39) I342V possibly damaging Het
Chd9 T C 8: 91,778,326 (GRCm39) M2779T probably damaging Het
Cnot3 C A 7: 3,661,221 (GRCm39) P577T probably benign Het
Col17a1 T C 19: 47,649,556 (GRCm39) D755G probably damaging Het
Col5a3 A G 9: 20,685,347 (GRCm39) V1443A unknown Het
Crygs C T 16: 22,624,082 (GRCm39) R175H probably damaging Het
Fam193a A G 5: 34,619,430 (GRCm39) D1031G probably damaging Het
Fam83b T A 9: 76,399,267 (GRCm39) H612L probably benign Het
Gabrr2 A G 4: 33,081,410 (GRCm39) T149A probably damaging Het
Gm3667 T C 14: 18,269,663 (GRCm39) N156D probably benign Het
Hpcal1 T A 12: 17,841,171 (GRCm39) L183Q probably damaging Het
Ilf2 G T 3: 90,394,777 (GRCm39) E342* probably null Het
Ints13 A G 6: 146,452,264 (GRCm39) S652P probably damaging Het
Kansl2 C A 15: 98,422,499 (GRCm39) E356D probably benign Het
Klhl6 T C 16: 19,768,201 (GRCm39) E448G probably null Het
Mmp14 A G 14: 54,673,707 (GRCm39) I124V probably benign Het
Morc2b A T 17: 33,354,747 (GRCm39) D1008E probably benign Het
Muc16 A C 9: 18,554,767 (GRCm39) V3842G unknown Het
Myo9b A T 8: 71,807,405 (GRCm39) I1614F probably benign Het
Nipa1 A T 7: 55,629,547 (GRCm39) C189S probably damaging Het
Ntn4 T C 10: 93,480,335 (GRCm39) probably benign Het
Or12k5 A G 2: 36,894,972 (GRCm39) I218T probably benign Het
Or3a4 A C 11: 73,944,982 (GRCm39) L201R probably damaging Het
Or4x13 A T 2: 90,231,395 (GRCm39) Y130F probably damaging Het
Or8g17 T G 9: 38,930,349 (GRCm39) I163L probably benign Het
Pank1 T A 19: 34,791,096 (GRCm39) H528L probably damaging Het
Pappa2 A T 1: 158,589,131 (GRCm39) L1698* probably null Het
Park7 A G 4: 150,988,341 (GRCm39) S85P probably damaging Het
Pik3r4 A G 9: 105,564,408 (GRCm39) D1334G probably damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Rapgef2 T C 3: 79,122,276 (GRCm39) E30G probably benign Het
Rhbdf1 A G 11: 32,160,523 (GRCm39) F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,229,113 (GRCm39) probably benign Het
Scd4 G T 19: 44,329,687 (GRCm39) M219I probably benign Het
Slfn5 T A 11: 82,847,613 (GRCm39) I166N probably benign Het
Smim22 A T 16: 4,826,089 (GRCm39) D85V probably damaging Het
Socs2 T C 10: 95,250,812 (GRCm39) E7G probably benign Het
Thumpd2 T C 17: 81,334,157 (GRCm39) E477G probably benign Het
Tlr12 C T 4: 128,510,483 (GRCm39) G589D probably benign Het
Ttn A T 2: 76,595,199 (GRCm39) I20317K probably damaging Het
Ttyh2 A G 11: 114,599,690 (GRCm39) probably null Het
Ugt2a3 T A 5: 87,475,050 (GRCm39) D398V probably damaging Het
Vmn2r88 A T 14: 51,650,589 (GRCm39) M101L Het
Vmn2r93 A T 17: 18,545,954 (GRCm39) R609* probably null Het
Zfp473 C T 7: 44,381,916 (GRCm39) E806K probably damaging Het
Zfp93 T C 7: 23,974,999 (GRCm39) L328P probably damaging Het
Other mutations in Or2t29
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Or2t29 UTSW 11 58,433,988 (GRCm39) missense possibly damaging 0.76
R2426:Or2t29 UTSW 11 58,433,920 (GRCm39) nonsense probably null
R4805:Or2t29 UTSW 11 58,433,396 (GRCm39) missense probably benign 0.03
R6498:Or2t29 UTSW 11 58,433,408 (GRCm39) missense probably damaging 1.00
R7341:Or2t29 UTSW 11 58,433,533 (GRCm39) nonsense probably null
R7768:Or2t29 UTSW 11 58,433,693 (GRCm39) missense possibly damaging 0.94
R7768:Or2t29 UTSW 11 58,433,466 (GRCm39) missense probably damaging 0.99
R8416:Or2t29 UTSW 11 58,433,778 (GRCm39) missense possibly damaging 0.75
R9076:Or2t29 UTSW 11 58,433,782 (GRCm39) nonsense probably null
R9606:Or2t29 UTSW 11 58,433,753 (GRCm39) missense probably damaging 1.00
Z1186:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1187:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1188:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1189:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1190:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1191:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Z1192:Or2t29 UTSW 11 58,434,272 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGAAAGAGGGGTTTTCACC -3'
(R):5'- TGGATGGCTTCATGCTCACC -3'

Sequencing Primer
(F):5'- AACAGTTTCTTCATAGCTTCTGTGAC -3'
(R):5'- ATGCTCACCCCTGTCACCATG -3'
Posted On 2020-09-15