Incidental Mutation 'R7957:Olfr329-ps'
List |< first << previous [record 30 of 52] next >> last >|
ID649904
Institutional Source Beutler Lab
Gene Symbol Olfr329-ps
Ensembl Gene ENSMUSG00000064252
Gene Nameolfactory receptor 329, pseudogene
SynonymsMOR275-6P, GA_x6K02T2NKPP-882068-883006
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R7957 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58539801-58546422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58542798 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 239 (L239P)
Ref Sequence ENSEMBL: ENSMUSP00000104450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108822] [ENSMUST00000108823] [ENSMUST00000219448]
Predicted Effect probably damaging
Transcript: ENSMUST00000108822
AA Change: L239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: L239P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108823
AA Change: L226P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104451
Gene: ENSMUSG00000064252
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219448
AA Change: L226P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Olfr329-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Olfr329-ps UTSW 11 58543162 missense possibly damaging 0.76
R2426:Olfr329-ps UTSW 11 58543094 nonsense probably null
R4805:Olfr329-ps UTSW 11 58542570 missense probably benign 0.03
R6498:Olfr329-ps UTSW 11 58542582 missense probably damaging 1.00
R7341:Olfr329-ps UTSW 11 58542707 nonsense probably null
R7768:Olfr329-ps UTSW 11 58542640 missense probably damaging 0.99
R7768:Olfr329-ps UTSW 11 58542867 missense possibly damaging 0.94
R8416:Olfr329-ps UTSW 11 58542952 missense possibly damaging 0.75
Z1186:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1187:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1188:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1189:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1190:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1191:Olfr329-ps UTSW 11 58543446 missense probably benign
Z1192:Olfr329-ps UTSW 11 58543446 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGAAAGAGGGGTTTTCACC -3'
(R):5'- TGGATGGCTTCATGCTCACC -3'

Sequencing Primer
(F):5'- AACAGTTTCTTCATAGCTTCTGTGAC -3'
(R):5'- ATGCTCACCCCTGTCACCATG -3'
Posted On2020-09-15