Incidental Mutation 'R7957:Abca8a'
ID 649907
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene Name ATP-binding cassette, sub-family A member 8a
Synonyms
MMRRC Submission 046001-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7957 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 109916460-109986804 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 109982439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000097860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106662] [ENSMUST00000106664]
AlphaFold Q8K442
Predicted Effect probably null
Transcript: ENSMUST00000046223
AA Change: M1T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100287
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106662
AA Change: M1T
SMART Domains Protein: ENSMUSP00000102273
Gene: ENSMUSG00000041828
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106664
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T A 7: 78,975,194 (GRCm39) M128K probably benign Het
Adamts12 A G 15: 11,317,298 (GRCm39) T1333A possibly damaging Het
Alg8 A G 7: 97,040,131 (GRCm39) T438A probably benign Het
Ccn3 G T 15: 54,609,734 (GRCm39) S78I possibly damaging Het
Cebpa A G 7: 34,819,867 (GRCm39) I342V possibly damaging Het
Chd9 T C 8: 91,778,326 (GRCm39) M2779T probably damaging Het
Cnot3 C A 7: 3,661,221 (GRCm39) P577T probably benign Het
Col17a1 T C 19: 47,649,556 (GRCm39) D755G probably damaging Het
Col5a3 A G 9: 20,685,347 (GRCm39) V1443A unknown Het
Crygs C T 16: 22,624,082 (GRCm39) R175H probably damaging Het
Fam193a A G 5: 34,619,430 (GRCm39) D1031G probably damaging Het
Fam83b T A 9: 76,399,267 (GRCm39) H612L probably benign Het
Gabrr2 A G 4: 33,081,410 (GRCm39) T149A probably damaging Het
Gm3667 T C 14: 18,269,663 (GRCm39) N156D probably benign Het
Hpcal1 T A 12: 17,841,171 (GRCm39) L183Q probably damaging Het
Ilf2 G T 3: 90,394,777 (GRCm39) E342* probably null Het
Ints13 A G 6: 146,452,264 (GRCm39) S652P probably damaging Het
Kansl2 C A 15: 98,422,499 (GRCm39) E356D probably benign Het
Klhl6 T C 16: 19,768,201 (GRCm39) E448G probably null Het
Mmp14 A G 14: 54,673,707 (GRCm39) I124V probably benign Het
Morc2b A T 17: 33,354,747 (GRCm39) D1008E probably benign Het
Muc16 A C 9: 18,554,767 (GRCm39) V3842G unknown Het
Myo9b A T 8: 71,807,405 (GRCm39) I1614F probably benign Het
Nipa1 A T 7: 55,629,547 (GRCm39) C189S probably damaging Het
Ntn4 T C 10: 93,480,335 (GRCm39) probably benign Het
Or12k5 A G 2: 36,894,972 (GRCm39) I218T probably benign Het
Or2t29 A G 11: 58,433,624 (GRCm39) L239P probably damaging Het
Or3a4 A C 11: 73,944,982 (GRCm39) L201R probably damaging Het
Or4x13 A T 2: 90,231,395 (GRCm39) Y130F probably damaging Het
Or8g17 T G 9: 38,930,349 (GRCm39) I163L probably benign Het
Pank1 T A 19: 34,791,096 (GRCm39) H528L probably damaging Het
Pappa2 A T 1: 158,589,131 (GRCm39) L1698* probably null Het
Park7 A G 4: 150,988,341 (GRCm39) S85P probably damaging Het
Pik3r4 A G 9: 105,564,408 (GRCm39) D1334G probably damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Rapgef2 T C 3: 79,122,276 (GRCm39) E30G probably benign Het
Rhbdf1 A G 11: 32,160,523 (GRCm39) F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,229,113 (GRCm39) probably benign Het
Scd4 G T 19: 44,329,687 (GRCm39) M219I probably benign Het
Slfn5 T A 11: 82,847,613 (GRCm39) I166N probably benign Het
Smim22 A T 16: 4,826,089 (GRCm39) D85V probably damaging Het
Socs2 T C 10: 95,250,812 (GRCm39) E7G probably benign Het
Thumpd2 T C 17: 81,334,157 (GRCm39) E477G probably benign Het
Tlr12 C T 4: 128,510,483 (GRCm39) G589D probably benign Het
Ttn A T 2: 76,595,199 (GRCm39) I20317K probably damaging Het
Ttyh2 A G 11: 114,599,690 (GRCm39) probably null Het
Ugt2a3 T A 5: 87,475,050 (GRCm39) D398V probably damaging Het
Vmn2r88 A T 14: 51,650,589 (GRCm39) M101L Het
Vmn2r93 A T 17: 18,545,954 (GRCm39) R609* probably null Het
Zfp473 C T 7: 44,381,916 (GRCm39) E806K probably damaging Het
Zfp93 T C 7: 23,974,999 (GRCm39) L328P probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 109,941,765 (GRCm39) missense possibly damaging 0.52
IGL01099:Abca8a APN 11 109,965,031 (GRCm39) splice site probably benign
IGL01100:Abca8a APN 11 109,949,249 (GRCm39) critical splice donor site probably null
IGL01310:Abca8a APN 11 109,950,801 (GRCm39) missense probably benign 0.02
IGL01357:Abca8a APN 11 109,922,398 (GRCm39) missense probably benign 0.05
IGL01554:Abca8a APN 11 109,932,992 (GRCm39) missense probably benign 0.24
IGL01937:Abca8a APN 11 109,974,130 (GRCm39) splice site probably benign
IGL01945:Abca8a APN 11 109,974,130 (GRCm39) splice site probably benign
IGL01987:Abca8a APN 11 109,964,981 (GRCm39) missense possibly damaging 0.63
IGL02023:Abca8a APN 11 109,953,942 (GRCm39) missense probably benign 0.04
IGL02208:Abca8a APN 11 109,950,772 (GRCm39) missense probably damaging 1.00
IGL02378:Abca8a APN 11 109,969,641 (GRCm39) unclassified probably benign
IGL02380:Abca8a APN 11 109,969,641 (GRCm39) unclassified probably benign
IGL02387:Abca8a APN 11 109,969,641 (GRCm39) unclassified probably benign
IGL02388:Abca8a APN 11 109,969,641 (GRCm39) unclassified probably benign
IGL02524:Abca8a APN 11 109,969,641 (GRCm39) unclassified probably benign
IGL02551:Abca8a APN 11 109,975,068 (GRCm39) missense probably benign 0.05
IGL02831:Abca8a APN 11 109,943,907 (GRCm39) missense probably damaging 1.00
IGL02836:Abca8a APN 11 109,961,177 (GRCm39) missense possibly damaging 0.89
IGL02934:Abca8a APN 11 109,931,414 (GRCm39) missense probably damaging 1.00
IGL02946:Abca8a APN 11 109,919,041 (GRCm39) splice site probably benign
IGL02967:Abca8a APN 11 109,941,762 (GRCm39) missense probably damaging 1.00
IGL02997:Abca8a APN 11 109,966,359 (GRCm39) splice site probably benign
IGL03265:Abca8a APN 11 109,943,929 (GRCm39) missense probably benign 0.01
G5030:Abca8a UTSW 11 109,961,165 (GRCm39) missense probably damaging 1.00
H8562:Abca8a UTSW 11 109,933,835 (GRCm39) missense probably benign
PIT4445001:Abca8a UTSW 11 109,966,377 (GRCm39) missense probably damaging 0.99
R0060:Abca8a UTSW 11 109,961,306 (GRCm39) missense probably damaging 1.00
R0060:Abca8a UTSW 11 109,961,306 (GRCm39) missense probably damaging 1.00
R0084:Abca8a UTSW 11 109,927,423 (GRCm39) splice site probably benign
R0394:Abca8a UTSW 11 109,917,169 (GRCm39) missense probably damaging 0.99
R0477:Abca8a UTSW 11 109,956,051 (GRCm39) missense probably benign
R0593:Abca8a UTSW 11 109,958,925 (GRCm39) missense probably damaging 1.00
R0744:Abca8a UTSW 11 109,931,390 (GRCm39) missense possibly damaging 0.91
R0764:Abca8a UTSW 11 109,950,772 (GRCm39) missense probably damaging 1.00
R0787:Abca8a UTSW 11 109,933,814 (GRCm39) missense possibly damaging 0.60
R0836:Abca8a UTSW 11 109,931,390 (GRCm39) missense possibly damaging 0.91
R0848:Abca8a UTSW 11 109,919,016 (GRCm39) missense probably damaging 1.00
R0894:Abca8a UTSW 11 109,941,792 (GRCm39) missense probably benign 0.00
R1163:Abca8a UTSW 11 109,962,356 (GRCm39) missense probably benign 0.01
R1224:Abca8a UTSW 11 109,931,408 (GRCm39) missense probably damaging 1.00
R1474:Abca8a UTSW 11 109,960,635 (GRCm39) missense probably damaging 1.00
R1596:Abca8a UTSW 11 109,958,886 (GRCm39) missense possibly damaging 0.89
R1708:Abca8a UTSW 11 109,943,928 (GRCm39) missense probably damaging 1.00
R1715:Abca8a UTSW 11 109,982,406 (GRCm39) missense probably damaging 0.98
R1795:Abca8a UTSW 11 109,941,792 (GRCm39) missense probably benign 0.00
R1832:Abca8a UTSW 11 109,962,277 (GRCm39) missense probably damaging 0.99
R1852:Abca8a UTSW 11 109,960,212 (GRCm39) missense probably damaging 1.00
R1887:Abca8a UTSW 11 109,980,768 (GRCm39) missense probably damaging 1.00
R1891:Abca8a UTSW 11 109,982,433 (GRCm39) missense probably benign 0.20
R1917:Abca8a UTSW 11 109,982,341 (GRCm39) splice site probably benign
R1943:Abca8a UTSW 11 109,960,689 (GRCm39) missense probably benign 0.00
R1962:Abca8a UTSW 11 109,917,731 (GRCm39) critical splice acceptor site probably null
R2016:Abca8a UTSW 11 109,961,213 (GRCm39) missense probably damaging 0.99
R2037:Abca8a UTSW 11 109,980,810 (GRCm39) splice site probably null
R2098:Abca8a UTSW 11 109,927,405 (GRCm39) missense probably damaging 1.00
R2102:Abca8a UTSW 11 109,958,878 (GRCm39) missense probably damaging 1.00
R2134:Abca8a UTSW 11 109,921,743 (GRCm39) missense probably null 1.00
R2220:Abca8a UTSW 11 109,917,681 (GRCm39) missense probably damaging 1.00
R2269:Abca8a UTSW 11 109,917,718 (GRCm39) missense probably damaging 1.00
R2395:Abca8a UTSW 11 109,959,614 (GRCm39) missense probably damaging 1.00
R2847:Abca8a UTSW 11 109,932,931 (GRCm39) missense probably damaging 1.00
R2849:Abca8a UTSW 11 109,932,931 (GRCm39) missense probably damaging 1.00
R3508:Abca8a UTSW 11 109,953,991 (GRCm39) missense probably benign
R3974:Abca8a UTSW 11 109,974,328 (GRCm39) missense probably damaging 1.00
R4009:Abca8a UTSW 11 109,980,933 (GRCm39) missense probably damaging 0.98
R4163:Abca8a UTSW 11 109,941,808 (GRCm39) missense probably benign 0.00
R4274:Abca8a UTSW 11 109,980,930 (GRCm39) missense probably damaging 0.96
R4507:Abca8a UTSW 11 109,953,851 (GRCm39) missense probably benign 0.19
R4571:Abca8a UTSW 11 109,920,884 (GRCm39) missense probably damaging 1.00
R4672:Abca8a UTSW 11 109,962,702 (GRCm39) missense possibly damaging 0.94
R4700:Abca8a UTSW 11 109,961,308 (GRCm39) missense probably damaging 1.00
R4770:Abca8a UTSW 11 109,962,341 (GRCm39) missense possibly damaging 0.82
R4946:Abca8a UTSW 11 109,977,300 (GRCm39) missense probably damaging 1.00
R4955:Abca8a UTSW 11 109,927,338 (GRCm39) missense probably benign 0.00
R5186:Abca8a UTSW 11 109,982,425 (GRCm39) missense probably null 0.31
R5190:Abca8a UTSW 11 109,980,735 (GRCm39) critical splice donor site probably null
R5597:Abca8a UTSW 11 109,927,363 (GRCm39) missense probably damaging 1.00
R5677:Abca8a UTSW 11 109,929,225 (GRCm39) missense possibly damaging 0.51
R5757:Abca8a UTSW 11 109,933,794 (GRCm39) missense probably benign 0.28
R5822:Abca8a UTSW 11 109,921,705 (GRCm39) missense probably damaging 0.98
R5925:Abca8a UTSW 11 109,948,049 (GRCm39) missense probably damaging 1.00
R6090:Abca8a UTSW 11 109,954,048 (GRCm39) critical splice acceptor site probably null
R6122:Abca8a UTSW 11 109,961,249 (GRCm39) missense probably benign 0.40
R6189:Abca8a UTSW 11 109,921,710 (GRCm39) missense probably damaging 1.00
R6200:Abca8a UTSW 11 109,980,876 (GRCm39) missense probably damaging 0.98
R6374:Abca8a UTSW 11 109,974,216 (GRCm39) nonsense probably null
R7022:Abca8a UTSW 11 109,974,326 (GRCm39) missense probably damaging 1.00
R7161:Abca8a UTSW 11 109,964,968 (GRCm39) missense probably benign 0.09
R7198:Abca8a UTSW 11 109,969,481 (GRCm39) missense probably damaging 1.00
R7220:Abca8a UTSW 11 109,980,793 (GRCm39) missense probably benign 0.00
R7290:Abca8a UTSW 11 109,921,714 (GRCm39) missense probably benign 0.03
R7381:Abca8a UTSW 11 109,920,913 (GRCm39) splice site probably null
R7437:Abca8a UTSW 11 109,941,790 (GRCm39) missense probably benign
R7733:Abca8a UTSW 11 109,945,413 (GRCm39) missense probably benign 0.02
R7785:Abca8a UTSW 11 109,965,032 (GRCm39) splice site probably null
R7917:Abca8a UTSW 11 109,958,933 (GRCm39) missense probably damaging 1.00
R7948:Abca8a UTSW 11 109,941,805 (GRCm39) missense probably benign
R7958:Abca8a UTSW 11 109,922,498 (GRCm39) missense probably damaging 1.00
R7981:Abca8a UTSW 11 109,980,739 (GRCm39) missense probably benign 0.00
R8033:Abca8a UTSW 11 109,927,348 (GRCm39) missense probably damaging 1.00
R8069:Abca8a UTSW 11 109,980,876 (GRCm39) missense probably damaging 0.98
R8116:Abca8a UTSW 11 109,982,420 (GRCm39) missense probably benign 0.27
R8289:Abca8a UTSW 11 109,927,515 (GRCm39) intron probably benign
R8334:Abca8a UTSW 11 109,959,650 (GRCm39) missense probably damaging 1.00
R8371:Abca8a UTSW 11 109,945,473 (GRCm39) missense probably benign 0.31
R8406:Abca8a UTSW 11 109,977,343 (GRCm39) missense probably damaging 1.00
R8438:Abca8a UTSW 11 109,966,404 (GRCm39) missense probably damaging 1.00
R8670:Abca8a UTSW 11 109,966,424 (GRCm39) missense probably damaging 1.00
R8807:Abca8a UTSW 11 109,974,252 (GRCm39) missense probably benign 0.35
R8821:Abca8a UTSW 11 109,949,362 (GRCm39) missense probably damaging 0.98
R8838:Abca8a UTSW 11 109,920,881 (GRCm39) missense probably damaging 1.00
R8884:Abca8a UTSW 11 109,964,941 (GRCm39) missense possibly damaging 0.60
R8885:Abca8a UTSW 11 109,960,305 (GRCm39) missense probably damaging 1.00
R8962:Abca8a UTSW 11 109,969,634 (GRCm39) missense probably damaging 1.00
R8966:Abca8a UTSW 11 109,962,245 (GRCm39) critical splice donor site probably null
R9272:Abca8a UTSW 11 109,953,908 (GRCm39) missense probably damaging 0.99
R9331:Abca8a UTSW 11 109,917,154 (GRCm39) missense probably damaging 1.00
R9397:Abca8a UTSW 11 109,921,173 (GRCm39) missense probably damaging 1.00
R9498:Abca8a UTSW 11 109,977,374 (GRCm39) missense probably damaging 0.99
R9529:Abca8a UTSW 11 109,947,167 (GRCm39) nonsense probably null
R9564:Abca8a UTSW 11 109,965,010 (GRCm39) missense probably benign 0.04
X0022:Abca8a UTSW 11 109,921,923 (GRCm39) missense probably damaging 1.00
X0024:Abca8a UTSW 11 109,974,161 (GRCm39) missense probably damaging 1.00
X0053:Abca8a UTSW 11 109,974,310 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCCCTAGTGAATGGCCTC -3'
(R):5'- TACACTGTTGAAGAAGTCTGAGAG -3'

Sequencing Primer
(F):5'- GTGGAGCCATGATTTTCTTCCCAG -3'
(R):5'- TGTTGAAGAAGTCTGAGAGTGAGAAG -3'
Posted On 2020-09-15