Incidental Mutation 'R7957:Hpcal1'
ID649908
Institutional Source Beutler Lab
Gene Symbol Hpcal1
Ensembl Gene ENSMUSG00000071379
Gene Namehippocalcin-like 1
SynonymsVnsl3, neural visinin-like 3, VILIP3, visinin like 3, Nvp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7957 (G1)
Quality Score106.008
Status Validated
Chromosome12
Chromosomal Location17690856-17791933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17791170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 183 (L183Q)
Ref Sequence ENSEMBL: ENSMUSP00000071756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071858] [ENSMUST00000222944]
Predicted Effect probably damaging
Transcript: ENSMUST00000071858
AA Change: L183Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071756
Gene: ENSMUSG00000071379
AA Change: L183Q

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 5.78e-7 SMART
EFh 148 176 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222944
Meta Mutation Damage Score 0.8881 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Hpcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Hpcal1 APN 12 17791145 missense probably benign 0.00
IGL00957:Hpcal1 APN 12 17787590 missense probably benign 0.17
R0137:Hpcal1 UTSW 12 17786388 missense probably damaging 1.00
R0920:Hpcal1 UTSW 12 17791097 splice site probably benign
R1490:Hpcal1 UTSW 12 17786224 missense probably benign
R5843:Hpcal1 UTSW 12 17791199 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGCTAGCAGCTTACTTCATG -3'
(R):5'- AACCATTGGAAGGAGCCAGC -3'

Sequencing Primer
(F):5'- ACATGTGTGCCTCAACATGG -3'
(R):5'- ACAGTTGGCCAGGTCAGG -3'
Posted On2020-09-15