Incidental Mutation 'R7957:Nov'
ID 649913
Institutional Source Beutler Lab
Gene Symbol Nov
Ensembl Gene ENSMUSG00000037362
Gene Name nephroblastoma overexpressed gene
Synonyms CCN3, C130088N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7957 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 54745702-54754039 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 54746338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 78 (S78I)
Ref Sequence ENSEMBL: ENSMUSP00000054389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050027]
AlphaFold Q64299
Predicted Effect possibly damaging
Transcript: ENSMUST00000050027
AA Change: S78I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054389
Gene: ENSMUSG00000037362
AA Change: S78I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IB 27 98 8.2e-34 SMART
VWC 104 167 6.08e-18 SMART
low complexity region 172 181 N/A INTRINSIC
TSP1 204 247 5.51e-7 SMART
CT 266 335 1.18e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development. [provided by RefSeq, Feb 2009]
PHENOTYPE: Heterozygotes and homozygotes for a null mutation exhibit abnormal skeletal and cardiac development, muscle atrophy and cataracts. Mice homozygous for another knock-out allele exhibit minor bone structure and physiology defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Nov
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Nov APN 15 54749260 missense probably damaging 1.00
IGL01480:Nov APN 15 54752291 missense probably damaging 1.00
IGL01727:Nov APN 15 54746238 missense probably benign 0.17
IGL02027:Nov APN 15 54747934 missense probably damaging 0.98
IGL02690:Nov APN 15 54747802 missense probably damaging 1.00
IGL03089:Nov APN 15 54749284 missense possibly damaging 0.72
IGL03229:Nov APN 15 54749308 missense probably benign 0.19
R0556:Nov UTSW 15 54749167 missense probably damaging 1.00
R1162:Nov UTSW 15 54747782 nonsense probably null
R1321:Nov UTSW 15 54749246 missense probably damaging 1.00
R1572:Nov UTSW 15 54749252 missense possibly damaging 0.89
R1994:Nov UTSW 15 54749354 missense probably benign
R2151:Nov UTSW 15 54752458 missense probably benign 0.10
R4785:Nov UTSW 15 54752207 critical splice acceptor site probably null
R5165:Nov UTSW 15 54749189 missense probably damaging 1.00
R5577:Nov UTSW 15 54752501 missense possibly damaging 0.54
R6131:Nov UTSW 15 54749360 missense probably benign 0.28
R6307:Nov UTSW 15 54748025 critical splice donor site probably null
R6472:Nov UTSW 15 54749272 missense possibly damaging 0.95
R6557:Nov UTSW 15 54747927 nonsense probably null
R7000:Nov UTSW 15 54752347 missense probably damaging 1.00
R7029:Nov UTSW 15 54747775 missense possibly damaging 0.89
R9030:Nov UTSW 15 54752291 missense probably damaging 1.00
X0063:Nov UTSW 15 54746321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTGGTTCGCCCCTGATAAC -3'
(R):5'- TGAAAGCTCTCCACACATGTC -3'

Sequencing Primer
(F):5'- GCCCCTGATAACCTGAGTTCG -3'
(R):5'- CACACATGTCAATTACTGTACTGC -3'
Posted On 2020-09-15