Incidental Mutation 'R7957:Nov'
List |< first << previous [record 26 of 52] next >> last >|
ID649913
Institutional Source Beutler Lab
Gene Symbol Nov
Ensembl Gene ENSMUSG00000037362
Gene Namenephroblastoma overexpressed gene
SynonymsCCN3, C130088N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54745702-54754039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54746338 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 78 (S78I)
Ref Sequence ENSEMBL: ENSMUSP00000054389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050027
AA Change: S78I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054389
Gene: ENSMUSG00000037362
AA Change: S78I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IB 27 98 8.2e-34 SMART
VWC 104 167 6.08e-18 SMART
low complexity region 172 181 N/A INTRINSIC
TSP1 204 247 5.51e-7 SMART
CT 266 335 1.18e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development. [provided by RefSeq, Feb 2009]
PHENOTYPE: Heterozygotes and homozygotes for a null mutation exhibit abnormal skeletal and cardiac development, muscle atrophy and cataracts. Mice homozygous for another knock-out allele exhibit minor bone structure and physiology defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Nov
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Nov APN 15 54749260 missense probably damaging 1.00
IGL01480:Nov APN 15 54752291 missense probably damaging 1.00
IGL01727:Nov APN 15 54746238 missense probably benign 0.17
IGL02027:Nov APN 15 54747934 missense probably damaging 0.98
IGL02690:Nov APN 15 54747802 missense probably damaging 1.00
IGL03089:Nov APN 15 54749284 missense possibly damaging 0.72
IGL03229:Nov APN 15 54749308 missense probably benign 0.19
R0556:Nov UTSW 15 54749167 missense probably damaging 1.00
R1162:Nov UTSW 15 54747782 nonsense probably null
R1321:Nov UTSW 15 54749246 missense probably damaging 1.00
R1572:Nov UTSW 15 54749252 missense possibly damaging 0.89
R1994:Nov UTSW 15 54749354 missense probably benign
R2151:Nov UTSW 15 54752458 missense probably benign 0.10
R4785:Nov UTSW 15 54752207 critical splice acceptor site probably null
R5165:Nov UTSW 15 54749189 missense probably damaging 1.00
R5577:Nov UTSW 15 54752501 missense possibly damaging 0.54
R6131:Nov UTSW 15 54749360 missense probably benign 0.28
R6307:Nov UTSW 15 54748025 critical splice donor site probably null
R6472:Nov UTSW 15 54749272 missense possibly damaging 0.95
R6557:Nov UTSW 15 54747927 nonsense probably null
R7000:Nov UTSW 15 54752347 missense probably damaging 1.00
R7029:Nov UTSW 15 54747775 missense possibly damaging 0.89
X0063:Nov UTSW 15 54746321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTGGTTCGCCCCTGATAAC -3'
(R):5'- TGAAAGCTCTCCACACATGTC -3'

Sequencing Primer
(F):5'- GCCCCTGATAACCTGAGTTCG -3'
(R):5'- CACACATGTCAATTACTGTACTGC -3'
Posted On2020-09-15