Incidental Mutation 'R7957:Smim22'
ID649915
Institutional Source Beutler Lab
Gene Symbol Smim22
Ensembl Gene ENSMUSG00000096215
Gene Namesmall integral membrane protein 22
SynonymsGm5480
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location5007288-5008309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5008225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 85 (D85V)
Ref Sequence ENSEMBL: ENSMUSP00000137083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023191] [ENSMUST00000090453] [ENSMUST00000178155] [ENSMUST00000184256] [ENSMUST00000184439] [ENSMUST00000185147] [ENSMUST00000201077] [ENSMUST00000202281]
Predicted Effect probably benign
Transcript: ENSMUST00000023191
SMART Domains Protein: ENSMUSP00000023191
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 298 9.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090453
SMART Domains Protein: ENSMUSP00000087938
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 210 1.2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178155
AA Change: D85V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137083
Gene: ENSMUSG00000096215
AA Change: D85V

DomainStartEndE-ValueType
Pfam:DUF4713 10 65 5.1e-29 PFAM
Predicted Effect silent
Transcript: ENSMUST00000184256
SMART Domains Protein: ENSMUSP00000138990
Gene: ENSMUSG00000096215

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184439
AA Change: D85V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139370
Gene: ENSMUSG00000096215
AA Change: D85V

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185147
AA Change: D80V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139067
Gene: ENSMUSG00000096215
AA Change: D80V

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201077
SMART Domains Protein: ENSMUSP00000144166
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 12 134 7.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202281
SMART Domains Protein: ENSMUSP00000144481
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 276 4.4e-49 PFAM
Meta Mutation Damage Score 0.2114 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Smim22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Smim22 APN 16 5007996 missense probably damaging 0.99
R1412:Smim22 UTSW 16 5007785 missense possibly damaging 0.95
R4556:Smim22 UTSW 16 5007866 missense possibly damaging 0.92
R4890:Smim22 UTSW 16 5007858 missense probably damaging 0.99
Z1177:Smim22 UTSW 16 5007360 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCACATCACATCTGGATGC -3'
(R):5'- TTGAATGTTGGCATCACAGC -3'

Sequencing Primer
(F):5'- ACATCACATCTGGATGCCTCTC -3'
(R):5'- CCCAAGGGGTAGCAGAAGTTG -3'
Posted On2020-09-15