Incidental Mutation 'R7957:Crygs'
ID649917
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Namecrystallin, gamma S
SynonymsOpj
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22805203-22811577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22805332 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 175 (R175H)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
PDB Structure NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000040592
AA Change: R175H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: R175H

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22806562 missense possibly damaging 0.81
R1694:Crygs UTSW 16 22806675 splice site probably null
R1932:Crygs UTSW 16 22806554 missense probably benign 0.12
R2206:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2275:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2298:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2299:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2300:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2326:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2329:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2330:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2331:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2332:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2857:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2895:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2896:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2921:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2922:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3120:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3196:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3427:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3609:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3611:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3625:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3693:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3694:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3695:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3870:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3871:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3876:Crygs UTSW 16 22806512 missense probably damaging 1.00
R4052:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4299:Crygs UTSW 16 22805411 nonsense probably null
R4630:Crygs UTSW 16 22805518 missense possibly damaging 0.90
R7392:Crygs UTSW 16 22806502 missense probably benign 0.35
R7573:Crygs UTSW 16 22805319 makesense probably null
R7954:Crygs UTSW 16 22805332 missense probably damaging 1.00
R7955:Crygs UTSW 16 22805332 missense probably damaging 1.00
R8172:Crygs UTSW 16 22806542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAATGCCCACTGTGGAGG -3'
(R):5'- GAAACCACGGAAGACTGTCC -3'

Sequencing Primer
(F):5'- GCCCAATTGCTGGTCCCTAAAAG -3'
(R):5'- GAAGACTGTCCTTCTATCATGGAGC -3'
Posted On2020-09-15