Incidental Mutation 'R7957:Morc2b'
ID649919
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R7957 (G1)
Quality Score223.009
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33135773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1008 (D1008E)
Ref Sequence ENSEMBL: ENSMUSP00000056879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably benign
Transcript: ENSMUST00000053896
AA Change: D1008E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: D1008E

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131954
AA Change: D1008E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: D1008E

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
twinkle UTSW 17 33135932 nonsense probably null
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
R7965:Morc2b UTSW 17 33135772 missense possibly damaging 0.91
R8164:Morc2b UTSW 17 33138040 missense probably damaging 0.99
R8283:Morc2b UTSW 17 33136701 missense probably benign 0.00
R8338:Morc2b UTSW 17 33136413 missense probably benign
R8349:Morc2b UTSW 17 33136801 missense probably benign 0.13
R8352:Morc2b UTSW 17 33137502 missense probably damaging 1.00
R8362:Morc2b UTSW 17 33138321 missense possibly damaging 0.91
R8364:Morc2b UTSW 17 33138240 missense probably benign 0.01
R8449:Morc2b UTSW 17 33136801 missense probably benign 0.13
R8452:Morc2b UTSW 17 33137502 missense probably damaging 1.00
R8476:Morc2b UTSW 17 33135859 missense possibly damaging 0.87
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAAGGATAGACATGCACAC -3'
(R):5'- AGAATCTCTGCCGCTCCTAC -3'

Sequencing Primer
(F):5'- ACATGCACACATAAATAATGAAAAGC -3'
(R):5'- GCTCCTACCAAAGATGTGCTG -3'
Posted On2020-09-15