Incidental Mutation 'R7957:Pank1'
ID649921
Institutional Source Beutler Lab
Gene Symbol Pank1
Ensembl Gene ENSMUSG00000033610
Gene Namepantothenate kinase 1
SynonymsPank1a, Pank1, 4632412I06Rik, Pank1b, 5430426F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34810894-34879455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34813696 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 528 (H528L)
Ref Sequence ENSEMBL: ENSMUSP00000043562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036584] [ENSMUST00000112460]
Predicted Effect probably damaging
Transcript: ENSMUST00000036584
AA Change: H528L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043562
Gene: ENSMUSG00000033610
AA Change: H528L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 135 147 N/A INTRINSIC
Pfam:Fumble 188 540 1.6e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112460
AA Change: H353L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108079
Gene: ENSMUSG00000033610
AA Change: H353L

DomainStartEndE-ValueType
Pfam:Fumble 13 365 3.8e-122 PFAM
Meta Mutation Damage Score 0.9618 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutant has increased body weight, polyphagia, decreased serum triglyceride and glucose levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Mmp14 A G 14: 54,436,250 I124V probably benign Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Pank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Pank1 APN 19 34840852 missense probably damaging 1.00
IGL02266:Pank1 APN 19 34813686 splice site probably benign
IGL02814:Pank1 APN 19 34840855 missense probably damaging 1.00
IGL03029:Pank1 APN 19 34821135 missense probably damaging 0.96
snowleopard UTSW 19 34812386 missense probably damaging 1.00
PIT4402001:Pank1 UTSW 19 34840966 missense probably damaging 1.00
R0388:Pank1 UTSW 19 34821706 splice site probably benign
R1254:Pank1 UTSW 19 34840860 missense probably benign 0.16
R1820:Pank1 UTSW 19 34877684 critical splice donor site probably null
R1928:Pank1 UTSW 19 34878881 missense probably benign
R2117:Pank1 UTSW 19 34841086 missense probably damaging 1.00
R2141:Pank1 UTSW 19 34878980 missense possibly damaging 0.91
R2147:Pank1 UTSW 19 34827354 missense probably benign 0.12
R2226:Pank1 UTSW 19 34827363 missense probably damaging 1.00
R4363:Pank1 UTSW 19 34827132 missense probably damaging 1.00
R4376:Pank1 UTSW 19 34877704 missense probably benign
R5081:Pank1 UTSW 19 34878916 missense probably benign
R5172:Pank1 UTSW 19 34840802 nonsense probably null
R6706:Pank1 UTSW 19 34812386 missense probably damaging 1.00
R6811:Pank1 UTSW 19 34841022 missense probably benign 0.37
R7637:Pank1 UTSW 19 34821988 splice site probably null
R8477:Pank1 UTSW 19 34878655 missense probably benign
R8725:Pank1 UTSW 19 34878589 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AACAGTCTTCAAATCTCCACTGTTG -3'
(R):5'- TACTGGGTCCTTACTAAATGCTC -3'

Sequencing Primer
(F):5'- CAAATCTCCACTGTTGGCTAAG -3'
(R):5'- ATGCTCTTTTAAAGCCATGGC -3'
Posted On2020-09-15