Incidental Mutation 'R7958:Cul3'
ID649925
Institutional Source Beutler Lab
Gene Symbol Cul3
Ensembl Gene ENSMUSG00000004364
Gene Namecullin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location80264923-80340480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80271557 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 666 (T666A)
Ref Sequence ENSEMBL: ENSMUSP00000130738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163119] [ENSMUST00000164108]
PDB Structure
Solution structure of the cullin-3 homologue [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000163119
AA Change: T666A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130738
Gene: ENSMUSG00000004364
AA Change: T666A

DomainStartEndE-ValueType
PDB:4AP2|B 1 389 N/A PDB
SCOP:d1ldja2 30 382 1e-117 SMART
Blast:CULLIN 258 295 2e-15 BLAST
CULLIN 413 563 1.98e-90 SMART
Cullin_Nedd8 695 762 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164108
AA Change: T600A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131891
Gene: ENSMUSG00000004364
AA Change: T600A

DomainStartEndE-ValueType
SCOP:d1ldja2 23 316 1e-101 SMART
PDB:4APF|B 23 323 N/A PDB
Blast:CULLIN 192 229 1e-15 BLAST
CULLIN 347 497 1.98e-90 SMART
Cullin_Nedd8 629 696 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168372
SMART Domains Protein: ENSMUSP00000132485
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
Cullin_Nedd8 38 105 3.28e-6 SMART
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a targeted null mutation accumulate cyclin E, exhibit abnormal cycling in cells of extraembryonic ectoderm and trophectoderm, reduced size, abnormal gastrulation and trophoblast cells, absence of an amnion, and death by embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Cul3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Cul3 APN 1 80288740 splice site probably benign
IGL01454:Cul3 APN 1 80304183 missense probably damaging 0.97
IGL01510:Cul3 APN 1 80282679 missense probably damaging 1.00
IGL01701:Cul3 APN 1 80277423 missense probably damaging 0.97
IGL02117:Cul3 APN 1 80323064 splice site probably benign
IGL02194:Cul3 APN 1 80323037 missense probably benign 0.03
IGL02217:Cul3 APN 1 80283767 missense probably damaging 0.97
IGL02417:Cul3 APN 1 80322902 missense probably damaging 1.00
IGL02445:Cul3 APN 1 80304169 missense possibly damaging 0.74
IGL02601:Cul3 APN 1 80271715 intron probably benign
IGL03201:Cul3 APN 1 80281427 missense probably damaging 1.00
R0467:Cul3 UTSW 1 80280863 missense probably benign 0.01
R0662:Cul3 UTSW 1 80271565 missense probably damaging 1.00
R0688:Cul3 UTSW 1 80271564 missense possibly damaging 0.63
R0761:Cul3 UTSW 1 80277486 unclassified probably benign
R0924:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0930:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0940:Cul3 UTSW 1 80322847 intron probably benign
R1117:Cul3 UTSW 1 80280924 missense probably damaging 1.00
R1572:Cul3 UTSW 1 80282789 missense possibly damaging 0.91
R2384:Cul3 UTSW 1 80283689 missense probably damaging 0.99
R3894:Cul3 UTSW 1 80283690 missense probably damaging 0.97
R4676:Cul3 UTSW 1 80271674 missense probably damaging 1.00
R4893:Cul3 UTSW 1 80288850 missense probably damaging 0.98
R4908:Cul3 UTSW 1 80280915 missense possibly damaging 0.91
R4910:Cul3 UTSW 1 80290089 missense probably benign 0.09
R5173:Cul3 UTSW 1 80281416 missense possibly damaging 0.94
R5787:Cul3 UTSW 1 80282721 missense probably benign 0.13
R5887:Cul3 UTSW 1 80276422 missense possibly damaging 0.94
R6057:Cul3 UTSW 1 80271532 missense probably damaging 1.00
R6066:Cul3 UTSW 1 80283759 missense probably benign 0.06
R6279:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6300:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6617:Cul3 UTSW 1 80276439 missense probably damaging 1.00
R7059:Cul3 UTSW 1 80276424 missense probably benign 0.00
R7223:Cul3 UTSW 1 80287000 missense probably benign 0.14
R7774:Cul3 UTSW 1 80269294 missense probably benign
Z1088:Cul3 UTSW 1 80290091 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTTTACAATTCCAAAACTTACCC -3'
(R):5'- TCTAGCTACCGCTTGATTGAC -3'

Sequencing Primer
(F):5'- ACAATTCCAAAACTTACCCTGTTTC -3'
(R):5'- AGCTACCGCTTGATTGACTTATTTG -3'
Posted On2020-09-15