Incidental Mutation 'R7958:Spo11'
ID649934
Institutional Source Beutler Lab
Gene Symbol Spo11
Ensembl Gene ENSMUSG00000005883
Gene NameSPO11 meiotic protein covalently bound to DSB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172977700-172993576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172984022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000059056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050442] [ENSMUST00000109125] [ENSMUST00000109126]
Predicted Effect probably benign
Transcript: ENSMUST00000050442
AA Change: D84E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059056
Gene: ENSMUSG00000005883
AA Change: D84E

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 6.3e-28 PFAM
Pfam:TP6A_N 107 170 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109125
AA Change: D46E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104753
Gene: ENSMUSG00000005883
AA Change: D46E

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1e-30 PFAM
Pfam:TP6A_N 66 133 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109126
AA Change: D46E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104754
Gene: ENSMUSG00000005883
AA Change: D46E

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1.1e-30 PFAM
Pfam:TP6A_N 102 146 1.9e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Mutant males exhibit loss of spermatocytes in early prophase, while mutant females exhibit oocyte loss soon after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Spo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Spo11 APN 2 172989032 critical splice donor site probably null
IGL02080:Spo11 APN 2 172989395 missense probably damaging 1.00
IGL02309:Spo11 APN 2 172979951 missense probably damaging 0.98
R3027:Spo11 UTSW 2 172985943 missense probably damaging 0.99
R4031:Spo11 UTSW 2 172986832 splice site probably benign
R5000:Spo11 UTSW 2 172989400 missense probably damaging 1.00
R5443:Spo11 UTSW 2 172989359 splice site probably benign
R7185:Spo11 UTSW 2 172982192 splice site probably null
R7486:Spo11 UTSW 2 172984077 missense probably benign 0.01
R7565:Spo11 UTSW 2 172992071 missense possibly damaging 0.65
R8120:Spo11 UTSW 2 172985458 missense probably damaging 0.98
X0061:Spo11 UTSW 2 172993050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACACGGAAGCAATGTGG -3'
(R):5'- GCTATCCAACTAGAAAGAGAGCTAAGC -3'

Sequencing Primer
(F):5'- GTCTACATTAACCGGTGAGCC -3'
(R):5'- GCTTGACCACTGTGTTCT -3'
Posted On2020-09-15