Incidental Mutation 'R7958:Oas2'
ID649939
Institutional Source Beutler Lab
Gene Symbol Oas2
Ensembl Gene ENSMUSG00000032690
Gene Name2'-5' oligoadenylate synthetase 2
Synonyms2'-5' oligoadenylate synthetase-like 11, Oasl11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120730333-120749853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120748766 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 112 (E112K)
Ref Sequence ENSEMBL: ENSMUSP00000080209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000053909] [ENSMUST00000081491]
Predicted Effect probably benign
Transcript: ENSMUST00000044833
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053909
AA Change: E112K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: E112K

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 190 378 5.6e-75 PFAM
Pfam:NTP_transf_2 412 516 4e-9 PFAM
Pfam:OAS1_C 533 724 3.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081491
AA Change: E112K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: E112K

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 191 376 1.9e-77 PFAM
Pfam:NTP_transf_2 412 516 1.3e-10 PFAM
Pfam:OAS1_C 534 722 2.6e-87 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Oas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL00784:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL01388:Oas2 APN 5 120748592 missense probably damaging 1.00
IGL01643:Oas2 APN 5 120736187 splice site probably benign
IGL01660:Oas2 APN 5 120741223 missense probably benign 0.00
IGL02346:Oas2 APN 5 120736088 missense probably benign 0.30
IGL02403:Oas2 APN 5 120748750 missense possibly damaging 0.59
IGL03297:Oas2 APN 5 120735085 missense possibly damaging 0.91
R0149:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0344:Oas2 UTSW 5 120743087 missense probably damaging 1.00
R0361:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0387:Oas2 UTSW 5 120745672 splice site probably benign
R0465:Oas2 UTSW 5 120735055 missense probably damaging 0.99
R2100:Oas2 UTSW 5 120745675 critical splice donor site probably null
R2324:Oas2 UTSW 5 120743274 missense probably benign 0.43
R2496:Oas2 UTSW 5 120748617 missense probably benign 0.00
R4357:Oas2 UTSW 5 120738669 critical splice donor site probably null
R4466:Oas2 UTSW 5 120749602 missense probably damaging 0.99
R4472:Oas2 UTSW 5 120741155 missense possibly damaging 0.81
R4632:Oas2 UTSW 5 120733481 missense probably benign 0.34
R4714:Oas2 UTSW 5 120733472 missense probably damaging 1.00
R4824:Oas2 UTSW 5 120738346 missense probably benign 0.32
R4872:Oas2 UTSW 5 120738534 missense probably damaging 1.00
R5629:Oas2 UTSW 5 120738451 nonsense probably null
R6351:Oas2 UTSW 5 120748538 missense probably benign
R6463:Oas2 UTSW 5 120734981 missense probably null 1.00
R6488:Oas2 UTSW 5 120738363 missense probably damaging 1.00
R6787:Oas2 UTSW 5 120738798 missense possibly damaging 0.77
R6945:Oas2 UTSW 5 120736139 missense probably benign 0.00
R7353:Oas2 UTSW 5 120738522 missense probably damaging 1.00
R7459:Oas2 UTSW 5 120749710 missense unknown
R7634:Oas2 UTSW 5 120733228 missense probably benign 0.18
R7639:Oas2 UTSW 5 120745686 nonsense probably null
R7968:Oas2 UTSW 5 120738372 missense probably benign 0.38
R8158:Oas2 UTSW 5 120749773 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GAGTATTCTCTGCCCTGGTAC -3'
(R):5'- TTAGCGCAGTTTTGAGTTGACC -3'

Sequencing Primer
(F):5'- GTCAAGGTATGCATCTTGG -3'
(R):5'- TTGACCCCAGTTTGGAGCTAGC -3'
Posted On2020-09-15