Incidental Mutation 'R7958:4930590J08Rik'
ID649941
Institutional Source Beutler Lab
Gene Symbol 4930590J08Rik
Ensembl Gene ENSMUSG00000034063
Gene NameRIKEN cDNA 4930590J08 gene
SynonymsLOC381798
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91902809-91950725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91934483 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 571 (T571S)
Ref Sequence ENSEMBL: ENSMUSP00000146101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059318] [ENSMUST00000205686]
Predicted Effect probably benign
Transcript: ENSMUST00000059318
AA Change: T571S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053778
Gene: ENSMUSG00000034063
AA Change: T571S

DomainStartEndE-ValueType
low complexity region 89 109 N/A INTRINSIC
Pfam:FAM194 357 561 4.1e-68 PFAM
low complexity region 626 637 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205686
AA Change: T571S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in 4930590J08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:4930590J08Rik APN 6 91919118 missense possibly damaging 0.74
IGL01478:4930590J08Rik APN 6 91934609 missense probably benign 0.01
IGL01481:4930590J08Rik APN 6 91933098 missense probably damaging 1.00
IGL01485:4930590J08Rik APN 6 91950022 missense probably damaging 0.96
IGL01794:4930590J08Rik APN 6 91918112 nonsense probably null
IGL01795:4930590J08Rik APN 6 91918112 nonsense probably null
IGL02040:4930590J08Rik APN 6 91918110 missense probably benign
IGL02171:4930590J08Rik APN 6 91944256 missense probably benign 0.01
IGL02968:4930590J08Rik APN 6 91923473 missense probably damaging 1.00
IGL03358:4930590J08Rik APN 6 91928735 missense probably damaging 1.00
PIT4519001:4930590J08Rik UTSW 6 91917057 missense probably damaging 1.00
R0531:4930590J08Rik UTSW 6 91915146 missense probably benign
R0569:4930590J08Rik UTSW 6 91942578 nonsense probably null
R1536:4930590J08Rik UTSW 6 91917035 missense probably benign 0.20
R1730:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1758:4930590J08Rik UTSW 6 91915222 missense possibly damaging 0.79
R1783:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1911:4930590J08Rik UTSW 6 91950069 splice site probably benign
R1930:4930590J08Rik UTSW 6 91915021 missense probably benign 0.01
R1936:4930590J08Rik UTSW 6 91917080 missense possibly damaging 0.90
R2157:4930590J08Rik UTSW 6 91917698 splice site probably null
R2157:4930590J08Rik UTSW 6 91942487 missense possibly damaging 0.48
R4072:4930590J08Rik UTSW 6 91945361 splice site probably null
R4662:4930590J08Rik UTSW 6 91914958 missense probably benign
R4900:4930590J08Rik UTSW 6 91918110 missense probably benign
R4936:4930590J08Rik UTSW 6 91944264 missense probably damaging 1.00
R5394:4930590J08Rik UTSW 6 91919193 missense probably benign 0.00
R5887:4930590J08Rik UTSW 6 91915143 nonsense probably null
R5931:4930590J08Rik UTSW 6 91919115 missense probably damaging 1.00
R6174:4930590J08Rik UTSW 6 91942536 missense probably damaging 0.99
R6179:4930590J08Rik UTSW 6 91942330 missense probably damaging 0.96
R6380:4930590J08Rik UTSW 6 91923137 missense probably damaging 1.00
R6531:4930590J08Rik UTSW 6 91949999 missense possibly damaging 0.88
R7570:4930590J08Rik UTSW 6 91934610 missense probably benign 0.03
R7860:4930590J08Rik UTSW 6 91928726 missense probably damaging 1.00
R7936:4930590J08Rik UTSW 6 91923464 nonsense probably null
R7968:4930590J08Rik UTSW 6 91945460 missense
R8111:4930590J08Rik UTSW 6 91917710 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGTGTTAGCTGCAGAGC -3'
(R):5'- AAGACTTTGACCTGGACTTTGCC -3'

Sequencing Primer
(F):5'- TGCAGAGCAAGGCAGGC -3'
(R):5'- GCCGTTCTTCTTTTGAACATGG -3'
Posted On2020-09-15