Incidental Mutation 'R7958:Alg8'
ID649946
Institutional Source Beutler Lab
Gene Symbol Alg8
Ensembl Gene ENSMUSG00000035704
Gene Nameasparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
SynonymsLOC381903
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97371606-97392185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97386921 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 340 (C340R)
Ref Sequence ENSEMBL: ENSMUSP00000095901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098300
AA Change: C340R

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095901
Gene: ENSMUSG00000035704
AA Change: C340R

DomainStartEndE-ValueType
Pfam:Alg6_Alg8 21 510 1.3e-165 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Alg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Alg8 APN 7 97378176 missense possibly damaging 0.81
IGL02349:Alg8 APN 7 97379894 missense possibly damaging 0.95
IGL02441:Alg8 APN 7 97380297 missense probably benign 0.04
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1109:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1429:Alg8 UTSW 7 97390292 missense probably benign 0.18
R3838:Alg8 UTSW 7 97388545 missense probably damaging 1.00
R5343:Alg8 UTSW 7 97386919 missense possibly damaging 0.53
R5622:Alg8 UTSW 7 97386799 splice site probably benign
R5910:Alg8 UTSW 7 97390286 missense possibly damaging 0.67
R5963:Alg8 UTSW 7 97379830 missense probably benign 0.00
R6484:Alg8 UTSW 7 97382928 missense probably benign
R6735:Alg8 UTSW 7 97382982 missense probably benign 0.05
R7896:Alg8 UTSW 7 97390916 missense probably damaging 1.00
R7957:Alg8 UTSW 7 97390924 missense probably benign 0.04
Z1176:Alg8 UTSW 7 97383761 missense probably benign 0.01
Z1177:Alg8 UTSW 7 97371662 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACCTGACTCATGAGCTATGG -3'
(R):5'- CACAGAGGCTTTCCTGGTAATC -3'

Sequencing Primer
(F):5'- CTGACTCATGAGCTATGGAATCC -3'
(R):5'- TCAAGGTTCTCTGAGAATTGCTAG -3'
Posted On2020-09-15