Incidental Mutation 'R7958:Hhatl'
ID649955
Institutional Source Beutler Lab
Gene Symbol Hhatl
Ensembl Gene ENSMUSG00000032523
Gene Namehedgehog acyltransferase-like
SynonymsGup1, 1110011D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121784016-121792507 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121784586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981] [ENSMUST00000214768]
Predicted Effect probably null
Transcript: ENSMUST00000035110
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098272
SMART Domains Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001

DomainStartEndE-ValueType
BTB 33 128 4.61e-29 SMART
BACK 133 239 9.46e-30 SMART
low complexity region 262 276 N/A INTRINSIC
Blast:BTB 300 355 2e-27 BLAST
Kelch 360 412 1.77e0 SMART
Kelch 413 462 1.29e-2 SMART
Kelch 463 510 4.68e-9 SMART
Kelch 511 557 2.06e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163981
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214768
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Hhatl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Hhatl APN 9 121789791 missense probably benign 0.21
R0270:Hhatl UTSW 9 121784720 missense probably benign 0.14
R0399:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0417:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0436:Hhatl UTSW 9 121788762 missense probably benign 0.00
R1741:Hhatl UTSW 9 121789059 missense possibly damaging 0.67
R2250:Hhatl UTSW 9 121788171 missense possibly damaging 0.67
R2284:Hhatl UTSW 9 121789582 missense probably damaging 1.00
R2513:Hhatl UTSW 9 121789170 missense probably benign 0.13
R4278:Hhatl UTSW 9 121784219 missense probably benign
R4717:Hhatl UTSW 9 121789877 missense probably damaging 1.00
R4851:Hhatl UTSW 9 121789011 missense probably damaging 1.00
R5759:Hhatl UTSW 9 121788277 missense probably damaging 1.00
R6330:Hhatl UTSW 9 121788225 splice site probably null
R6387:Hhatl UTSW 9 121790401 missense probably benign 0.09
R6460:Hhatl UTSW 9 121789522 missense probably benign 0.32
R6541:Hhatl UTSW 9 121785144 missense probably damaging 1.00
R6651:Hhatl UTSW 9 121784702 missense probably damaging 1.00
R6670:Hhatl UTSW 9 121789071 missense probably damaging 0.96
R6914:Hhatl UTSW 9 121788180 missense probably benign
R6942:Hhatl UTSW 9 121788180 missense probably benign
R7026:Hhatl UTSW 9 121788273 missense probably benign 0.26
R7251:Hhatl UTSW 9 121785050 critical splice donor site probably null
R7323:Hhatl UTSW 9 121789586 missense probably benign
R8365:Hhatl UTSW 9 121789865 missense probably damaging 1.00
R8425:Hhatl UTSW 9 121789102 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATCCTTGAGACTCTGCCTCG -3'
(R):5'- CCTCTTGTTGACATATTCTTGGACG -3'

Sequencing Primer
(F):5'- GAGACTCTGCCTCGCATCAC -3'
(R):5'- ACATATTCTTGGACGGCAGGC -3'
Posted On2020-09-15