Incidental Mutation 'R7958:Map7'
ID649956
Institutional Source Beutler Lab
Gene Symbol Map7
Ensembl Gene ENSMUSG00000019996
Gene Namemicrotubule-associated protein 7
SynonymsE-MAP-115, mste, ste, Mtap7, mshi
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20148471-20281590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20229829 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 9 (S9T)
Ref Sequence ENSEMBL: ENSMUSP00000151101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259] [ENSMUST00000213312] [ENSMUST00000214231] [ENSMUST00000215924]
Predicted Effect probably benign
Transcript: ENSMUST00000020173
SMART Domains Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 447 616 1.1e-59 PFAM
internal_repeat_1 623 658 5.23e-6 PROSPERO
internal_repeat_1 699 736 5.23e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000116259
SMART Domains Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 453 611 4.7e-46 PFAM
internal_repeat_1 623 656 2.41e-5 PROSPERO
internal_repeat_1 699 734 2.41e-5 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000213312
AA Change: S9T
Predicted Effect probably benign
Transcript: ENSMUST00000214231
Predicted Effect probably benign
Transcript: ENSMUST00000215924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Map7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Map7 APN 10 20273804 missense unknown
IGL03019:Map7 APN 10 20267355 missense unknown
IGL03263:Map7 APN 10 20245322 nonsense probably null
R0893:Map7 UTSW 10 20273883 splice site probably null
R1172:Map7 UTSW 10 20245299 missense probably damaging 1.00
R2097:Map7 UTSW 10 20246616 missense probably damaging 1.00
R2239:Map7 UTSW 10 20278282 missense unknown
R3760:Map7 UTSW 10 20276281 splice site probably benign
R3980:Map7 UTSW 10 20267353 missense unknown
R5009:Map7 UTSW 10 20261918 nonsense probably null
R5397:Map7 UTSW 10 20273321 missense unknown
R5422:Map7 UTSW 10 20266766 missense probably damaging 0.99
R5501:Map7 UTSW 10 20276202 missense unknown
R5664:Map7 UTSW 10 20267359 missense unknown
R5773:Map7 UTSW 10 20246644 missense probably benign 0.22
R6209:Map7 UTSW 10 20276280 splice site probably null
R6438:Map7 UTSW 10 20267257 missense unknown
R6446:Map7 UTSW 10 20278233 missense unknown
R6919:Map7 UTSW 10 20171082 start gained probably benign
R7327:Map7 UTSW 10 20233462 missense unknown
R7440:Map7 UTSW 10 20261859 missense probably damaging 1.00
R7596:Map7 UTSW 10 20278181 missense unknown
R8517:Map7 UTSW 10 20261835 missense probably damaging 0.96
X0022:Map7 UTSW 10 20269582 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTGATCTTAAGATTCCCGAGGG -3'
(R):5'- CAAGTGCCTTTGACCTCCAG -3'

Sequencing Primer
(F):5'- TTCCCGAGGGTAAGGACTATC -3'
(R):5'- TCACTCTGTTCACACATCCATGATC -3'
Posted On2020-09-15