Incidental Mutation 'R7958:Aldh1l2'
ID 649958
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 046002-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7958 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83356202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: V176I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V176I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: V63I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,911,464 (GRCm39) T571S probably benign Het
Abca8a A G 11: 109,922,498 (GRCm39) Y1362H probably damaging Het
Alg8 T C 7: 97,036,128 (GRCm39) C340R possibly damaging Het
BC028528 T C 3: 95,796,224 (GRCm39) D46G probably benign Het
Cdh5 A T 8: 104,839,649 (GRCm39) H40L probably benign Het
Cul3 T C 1: 80,249,274 (GRCm39) T666A probably benign Het
Cwc27 T C 13: 104,941,472 (GRCm39) D150G probably benign Het
Cyp2a12 T A 7: 26,728,677 (GRCm39) N49K probably benign Het
Dhrs4 T C 14: 55,725,078 (GRCm39) L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Fam171a1 T A 2: 3,179,298 (GRCm39) S41R probably damaging Het
Fam186a A T 15: 99,841,189 (GRCm39) L1685H probably damaging Het
Fgfr1 G T 8: 26,022,358 (GRCm39) W2L probably benign Het
Fpr-rs6 T A 17: 20,402,705 (GRCm39) I219F probably damaging Het
Gm28360 T A 1: 117,781,409 (GRCm39) C133* probably null Het
Herc1 A G 9: 66,393,475 (GRCm39) D4118G probably damaging Het
Hhatl A G 9: 121,613,652 (GRCm39) probably null Het
Inpp4b T A 8: 82,696,218 (GRCm39) L384H probably damaging Het
Klhl12 G A 1: 134,395,455 (GRCm39) R139K probably benign Het
Klrg1 T A 6: 122,248,331 (GRCm39) *189C probably null Het
Krtap19-4 A G 16: 88,681,833 (GRCm39) F41S unknown Het
Lifr T C 15: 7,211,478 (GRCm39) V672A possibly damaging Het
Lrrc25 A G 8: 71,070,497 (GRCm39) T93A possibly damaging Het
Map7 T A 10: 20,105,575 (GRCm39) S9T unknown Het
Mycbp2 A T 14: 103,367,400 (GRCm39) F4281L probably benign Het
Myh10 A G 11: 68,612,173 (GRCm39) I162V probably benign Het
Myo18a T C 11: 77,732,383 (GRCm39) V1293A probably damaging Het
Nipbl A G 15: 8,340,742 (GRCm39) S1993P possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Oas2 C T 5: 120,886,831 (GRCm39) E112K probably benign Het
Oosp3 A T 19: 11,682,820 (GRCm39) I163F probably benign Het
Or8a1 A G 9: 37,641,682 (GRCm39) F199S probably damaging Het
Phkb G T 8: 86,748,292 (GRCm39) E710D probably benign Het
Plekhg4 A T 8: 106,103,281 (GRCm39) D318V possibly damaging Het
Potefam1 T C 2: 111,000,670 (GRCm39) E183G unknown Het
Ptprj T C 2: 90,299,971 (GRCm39) I277V possibly damaging Het
Ranbp17 A G 11: 33,437,702 (GRCm39) S179P probably damaging Het
Scaf8 G A 17: 3,221,397 (GRCm39) V295M unknown Het
Scn3a T A 2: 65,336,537 (GRCm39) I690F probably damaging Het
Serpinb1b A T 13: 33,273,636 (GRCm39) K110N possibly damaging Het
Sgsh T C 11: 119,243,599 (GRCm39) N41S probably damaging Het
Sh2d1b1 A G 1: 170,110,704 (GRCm39) T67A probably benign Het
Skint5 A T 4: 113,480,980 (GRCm39) L958M unknown Het
Spg11 T A 2: 121,923,426 (GRCm39) probably null Het
Spo11 T A 2: 172,825,815 (GRCm39) D84E probably benign Het
Spta1 G A 1: 174,001,956 (GRCm39) E29K probably benign Het
Srrm2 T C 17: 24,040,286 (GRCm39) V2310A probably benign Het
Tbc1d30 C A 10: 121,107,962 (GRCm39) R480L probably benign Het
Tbpl2 A T 2: 23,985,079 (GRCm39) probably null Het
Tjp3 C T 10: 81,118,828 (GRCm39) V69I possibly damaging Het
Ube3b T C 5: 114,539,484 (GRCm39) V425A probably benign Het
Vmn1r151 A T 7: 22,198,492 (GRCm39) S204R probably damaging Het
Vmn1r42 A T 6: 89,822,059 (GRCm39) I170N probably damaging Het
Vmn1r65 A G 7: 6,011,254 (GRCm39) S327P probably benign Het
Vmn2r104 T C 17: 20,262,988 (GRCm39) I158V probably benign Het
Wdr49 T A 3: 75,338,454 (GRCm39) M21L probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTCACAGACTTTCAAGCTCC -3'
(R):5'- AGGCCACTATCTGCGTTTGC -3'

Sequencing Primer
(F):5'- GCTCCAATTTACATTACAGCCATGTG -3'
(R):5'- GCGTTTGCAATGTAACCTCC -3'
Posted On 2020-09-15