Incidental Mutation 'R7958:Ranbp17'
ID649960
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33487702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 179 (S179P)
Ref Sequence ENSEMBL: ENSMUSP00000099879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179] [ENSMUST00000147751]
Predicted Effect probably damaging
Transcript: ENSMUST00000037522
AA Change: S179P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594
AA Change: S179P

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102815
AA Change: S179P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: S179P

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129179
AA Change: S179P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594
AA Change: S179P

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147751
AA Change: S174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118519
Gene: ENSMUSG00000040594
AA Change: S174P

DomainStartEndE-ValueType
IBN_N 25 90 3.24e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
PIT4445001:Ranbp17 UTSW 11 33481020 critical splice donor site probably null
PIT4480001:Ranbp17 UTSW 11 33297340 critical splice donor site probably null
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
R7096:Ranbp17 UTSW 11 33474896 missense probably benign
R7156:Ranbp17 UTSW 11 33297420 missense probably damaging 1.00
R7451:Ranbp17 UTSW 11 33284114 splice site probably null
RF016:Ranbp17 UTSW 11 33329511 missense probably damaging 0.99
X0013:Ranbp17 UTSW 11 33289562 splice site probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Z1176:Ranbp17 UTSW 11 33481108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTCATCTTCCATACTCAG -3'
(R):5'- TCCCTCGCAGTCTTTGACAAG -3'

Sequencing Primer
(F):5'- TATTTAAGACTGACCACACAAGTCTC -3'
(R):5'- GCAGTCTTTGACAAGCTCTG -3'
Posted On2020-09-15