Incidental Mutation 'R7958:Sgsh'
ID649964
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene NameN-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonymssulphamidase, 4632406A19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119343425-119355536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119352773 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 41 (N41S)
Ref Sequence ENSEMBL: ENSMUSP00000005173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
Predicted Effect probably damaging
Transcript: ENSMUST00000005173
AA Change: N41S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: N41S

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100172
AA Change: N41S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: N41S

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136523
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119346485 missense probably benign
IGL01549:Sgsh APN 11 119350929 missense probably damaging 0.99
IGL02110:Sgsh APN 11 119352806 missense probably damaging 1.00
IGL02878:Sgsh APN 11 119346558 missense probably damaging 1.00
hindenburg UTSW 11 119350947 missense probably damaging 1.00
ludendorff UTSW 11 119346357 missense probably damaging 1.00
BB005:Sgsh UTSW 11 119347735 missense probably benign 0.03
BB015:Sgsh UTSW 11 119347735 missense probably benign 0.03
R1187:Sgsh UTSW 11 119346578 nonsense probably null
R2342:Sgsh UTSW 11 119347714 missense probably benign 0.01
R2472:Sgsh UTSW 11 119355474 missense possibly damaging 0.83
R2571:Sgsh UTSW 11 119350514 missense probably damaging 1.00
R3872:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3873:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3874:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3875:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R5075:Sgsh UTSW 11 119346768 missense probably benign 0.34
R5660:Sgsh UTSW 11 119350981 missense probably damaging 1.00
R5938:Sgsh UTSW 11 119346799 missense probably benign 0.08
R7302:Sgsh UTSW 11 119347699 missense probably benign 0.02
R7484:Sgsh UTSW 11 119346357 missense probably damaging 1.00
R7533:Sgsh UTSW 11 119347870 missense probably damaging 1.00
R7552:Sgsh UTSW 11 119346552 missense probably damaging 1.00
R7928:Sgsh UTSW 11 119347735 missense probably benign 0.03
R8013:Sgsh UTSW 11 119352695 missense probably damaging 0.97
R8014:Sgsh UTSW 11 119352695 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCTAAGGATGCAAGGGAAACC -3'
(R):5'- CAGGCTTTCCTTCTTCTGGGAG -3'

Sequencing Primer
(F):5'- TAGCACCTCCCAGGAGAGAG -3'
(R):5'- GAGTGTCTAGTCCAACTCCTGAG -3'
Posted On2020-09-15