Incidental Mutation 'R7958:Serpinb1b'
ID649965
Institutional Source Beutler Lab
Gene Symbol Serpinb1b
Ensembl Gene ENSMUSG00000051029
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonymsovalbumin, EIB, 6330533H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7958 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33078575-33094380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33089653 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 110 (K110N)
Ref Sequence ENSEMBL: ENSMUSP00000016951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016951] [ENSMUST00000222973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016951
AA Change: K110N

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016951
Gene: ENSMUSG00000051029
AA Change: K110N

DomainStartEndE-ValueType
SERPIN 13 382 9e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222973
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Serpinb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Serpinb1b APN 13 33093867 missense probably damaging 1.00
IGL01348:Serpinb1b APN 13 33091415 missense probably benign 0.25
IGL01413:Serpinb1b APN 13 33093859 missense probably damaging 0.98
IGL01942:Serpinb1b APN 13 33085311 missense possibly damaging 0.69
IGL02065:Serpinb1b APN 13 33091318 missense possibly damaging 0.66
IGL02707:Serpinb1b APN 13 33091665 missense probably benign 0.41
IGL03149:Serpinb1b APN 13 33085292 missense possibly damaging 0.90
R0087:Serpinb1b UTSW 13 33085319 missense probably benign 0.02
R0279:Serpinb1b UTSW 13 33093713 missense possibly damaging 0.81
R0448:Serpinb1b UTSW 13 33089692 missense probably benign 0.01
R1605:Serpinb1b UTSW 13 33093663 missense possibly damaging 0.82
R1628:Serpinb1b UTSW 13 33093654 missense probably benign 0.00
R1955:Serpinb1b UTSW 13 33085439 missense probably benign 0.08
R6124:Serpinb1b UTSW 13 33093813 missense probably benign 0.01
R6632:Serpinb1b UTSW 13 33087455 missense probably damaging 0.97
R7205:Serpinb1b UTSW 13 33087423 missense probably benign 0.07
R7296:Serpinb1b UTSW 13 33093827 missense probably benign 0.30
R7475:Serpinb1b UTSW 13 33093565 missense probably benign 0.01
R7624:Serpinb1b UTSW 13 33091639 splice site probably null
R8058:Serpinb1b UTSW 13 33085310 missense probably benign 0.01
R8325:Serpinb1b UTSW 13 33093601 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGCTATACTTGCCATTTCTGC -3'
(R):5'- CGTTTGTGAAACACTGGTTTATCC -3'

Sequencing Primer
(F):5'- ATACTTGCCATTTCTGCACTGTAAC -3'
(R):5'- GAACAGGCCTCCTCTGAAATGTTG -3'
Posted On2020-09-15