Incidental Mutation 'R7958:Dusp9'
ID649978
Institutional Source Beutler Lab
Gene Symbol Dusp9
Ensembl Gene ENSMUSG00000031383
Gene Namedual specificity phosphatase 9
SynonymsMpk4, Pyst3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7958 (G1)
Quality Score205.475
Status Not validated
ChromosomeX
Chromosomal Location73639419-73643514 bp(+) (GRCm38)
Type of Mutationsmall deletion (16 aa in frame mutation)
DNA Base Change (assembly) TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG at 73640611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019701]
Predicted Effect probably benign
Transcript: ENSMUST00000019701
SMART Domains Protein: ENSMUSP00000019701
Gene: ENSMUSG00000031383

DomainStartEndE-ValueType
RHOD 8 204 2.51e-9 SMART
low complexity region 236 249 N/A INTRINSIC
DSPc 271 411 6.09e-67 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product shows selectivity for members of the ERK family of MAP kinases and is localized to the cytoplasm and nucleus. Aberrant expression of this gene is associated with type 2 diabetes and cancer progression in several cell types. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Hemizygous null male and heterozygous null female mice display embryonic lethality during organogenesis with abnormal placental labyrinth morphology when the allele is maternally inherited. Tetraploid rescue produces viable heterozygous and hemizygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,170,325 E183G unknown Het
4930590J08Rik A T 6: 91,934,483 T571S probably benign Het
Abca8a A G 11: 110,031,672 Y1362H probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Alg8 T C 7: 97,386,921 C340R possibly damaging Het
BC028528 T C 3: 95,888,912 D46G probably benign Het
Cdh5 A T 8: 104,113,017 H40L probably benign Het
Cul3 T C 1: 80,271,557 T666A probably benign Het
Cwc27 T C 13: 104,804,964 D150G probably benign Het
Cyp2a12 T A 7: 27,029,252 N49K probably benign Het
Dhrs4 T C 14: 55,487,621 L191P probably damaging Het
Fam171a1 T A 2: 3,178,261 S41R probably damaging Het
Fam186a A T 15: 99,943,308 L1685H probably damaging Het
Fgfr1 G T 8: 25,532,342 W2L probably benign Het
Fpr-rs6 T A 17: 20,182,443 I219F probably damaging Het
Gm28360 T A 1: 117,853,679 C133* probably null Het
Herc1 A G 9: 66,486,193 D4118G probably damaging Het
Hhatl A G 9: 121,784,586 probably null Het
Inpp4b T A 8: 81,969,589 L384H probably damaging Het
Klhl12 G A 1: 134,467,717 R139K probably benign Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Krtap19-4 A G 16: 88,884,945 F41S unknown Het
Lifr T C 15: 7,181,997 V672A possibly damaging Het
Lrrc25 A G 8: 70,617,847 T93A possibly damaging Het
Map7 T A 10: 20,229,829 S9T unknown Het
Mycbp2 A T 14: 103,129,964 F4281L probably benign Het
Myh10 A G 11: 68,721,347 I162V probably benign Het
Myo18a T C 11: 77,841,557 V1293A probably damaging Het
Nipbl A G 15: 8,311,258 S1993P possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Oas2 C T 5: 120,748,766 E112K probably benign Het
Olfr151 A G 9: 37,730,386 F199S probably damaging Het
Oosp3 A T 19: 11,705,456 I163F probably benign Het
Phkb G T 8: 86,021,663 E710D probably benign Het
Plekhg4 A T 8: 105,376,649 D318V possibly damaging Het
Ptprj T C 2: 90,469,627 I277V possibly damaging Het
Ranbp17 A G 11: 33,487,702 S179P probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Serpinb1b A T 13: 33,089,653 K110N possibly damaging Het
Sgsh T C 11: 119,352,773 N41S probably damaging Het
Sh2d1b1 A G 1: 170,283,135 T67A probably benign Het
Skint5 A T 4: 113,623,783 L958M unknown Het
Spg11 T A 2: 122,092,945 probably null Het
Spo11 T A 2: 172,984,022 D84E probably benign Het
Spta1 G A 1: 174,174,390 E29K probably benign Het
Srrm2 T C 17: 23,821,312 V2310A probably benign Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tbpl2 A T 2: 24,095,067 probably null Het
Tjp3 C T 10: 81,282,994 V69I possibly damaging Het
Ube3b T C 5: 114,401,423 V425A probably benign Het
Vmn1r151 A T 7: 22,499,067 S204R probably damaging Het
Vmn1r42 A T 6: 89,845,077 I170N probably damaging Het
Vmn1r65 A G 7: 6,008,255 S327P probably benign Het
Vmn2r104 T C 17: 20,042,726 I158V probably benign Het
Wdr49 T A 3: 75,431,147 M21L probably benign Het
Other mutations in Dusp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02968:Dusp9 APN X 73641433 missense probably benign 0.00
R4654:Dusp9 UTSW X 73640772 missense probably benign 0.31
R7075:Dusp9 UTSW X 73640611 small deletion probably benign
R7389:Dusp9 UTSW X 73640611 small deletion probably benign
R7412:Dusp9 UTSW X 73640611 small deletion probably benign
R7930:Dusp9 UTSW X 73640522 small deletion probably benign
R8228:Dusp9 UTSW X 73640611 small deletion probably benign
R8258:Dusp9 UTSW X 73640611 small deletion probably benign
R8334:Dusp9 UTSW X 73640611 small deletion probably benign
RF030:Dusp9 UTSW X 73640611 small deletion probably benign
RF039:Dusp9 UTSW X 73640611 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAGAGTCTGAGTCGGTCATG -3'
(R):5'- TGACCCTCACTTACCCTGTAGG -3'

Sequencing Primer
(F):5'- AGCTGTATGAGTCGGCGC -3'
(R):5'- CCCTGTAGGTAGTATGCTGGG -3'
Posted On2020-09-15