Incidental Mutation 'R7959:Gm8251'
ID649979
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7959 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44057568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1457 (I1457V)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: I1457V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: I1457V

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,357 N131K probably damaging Het
Ahnak T C 19: 9,010,649 V3099A possibly damaging Het
Apba2 A G 7: 64,695,823 M254V probably benign Het
Bbs7 C T 3: 36,602,936 D248N probably damaging Het
Cldn8 A G 16: 88,562,941 V32A probably damaging Het
Col4a4 G T 1: 82,507,059 P496T unknown Het
Cyp27a1 T A 1: 74,737,077 N417K probably benign Het
Dnah7a T C 1: 53,643,462 D283G probably benign Het
Fmn1 T A 2: 113,365,622 Y556N unknown Het
Fsip2 T C 2: 82,985,776 I3951T possibly damaging Het
Gigyf1 C T 5: 137,524,319 T773I probably damaging Het
Gm11639 A G 11: 105,042,801 K4878E probably damaging Het
Heatr6 A T 11: 83,781,363 K1066* probably null Het
Ikbkap A T 4: 56,774,737 M746K probably damaging Het
Mdfic T C 6: 15,741,071 S142P possibly damaging Het
Mettl16 A G 11: 74,817,026 I389V probably benign Het
Mia3 T C 1: 183,344,339 Y57C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup160 T C 2: 90,713,895 probably null Het
Olfr12 T A 1: 92,620,307 C134S probably damaging Het
Olfr138 A G 17: 38,275,711 *313W probably null Het
Olfr20 T C 11: 73,353,918 L55P probably damaging Het
Olfr628 T A 7: 103,732,808 V294D probably damaging Het
Olfr904 T A 9: 38,464,915 S291R probably damaging Het
Plcxd1 A T 5: 110,103,556 I333F probably damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Plxna2 C A 1: 194,810,962 S1848R probably damaging Het
Pnpla2 T A 7: 141,457,493 D136E probably benign Het
Polr1b T A 2: 129,108,094 F245I probably damaging Het
Prmt9 T A 8: 77,560,965 I245N probably damaging Het
Serhl A T 15: 83,101,872 D62V probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Spata13 C T 14: 60,756,230 R1044* probably null Het
Strbp G A 2: 37,640,894 T116I probably benign Het
Supt5 T C 7: 28,315,799 D977G probably benign Het
Tmem184c A G 8: 77,602,903 V176A possibly damaging Het
Uhrf2 A G 19: 30,086,260 N541S probably damaging Het
Vmn2r24 T A 6: 123,778,990 F7Y possibly damaging Het
Vmn2r27 T C 6: 124,192,081 R697G probably benign Het
Zfp994 A G 17: 22,202,780 V18A probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGTGGCAGTATGGATGCAC -3'
(R):5'- TTACAGAACCGTGACTCTCG -3'

Sequencing Primer
(F):5'- TGGCAGTATGGATGCACTTAAATAAG -3'
(R):5'- CTCCAAAAGTTGATACTATACATGCC -3'
Posted On2020-09-15