Incidental Mutation 'R7959:Apba2'
ID 650002
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Name amyloid beta precursor protein binding family A member 2
Synonyms X11L, Mint 2, X11-like
MMRRC Submission 046003-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R7959 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 64151454-64403626 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64345571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 254 (M254V)
Ref Sequence ENSEMBL: ENSMUSP00000032732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000205604] [ENSMUST00000205613] [ENSMUST00000206246]
AlphaFold P98084
Predicted Effect probably benign
Transcript: ENSMUST00000032732
AA Change: M254V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: M254V

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205604
Predicted Effect probably benign
Transcript: ENSMUST00000205613
Predicted Effect probably benign
Transcript: ENSMUST00000206246
AA Change: M254V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,988,013 (GRCm39) V3099A possibly damaging Het
Bbs7 C T 3: 36,657,085 (GRCm39) D248N probably damaging Het
Ccdc168 T C 1: 44,096,728 (GRCm39) I1457V probably benign Het
Cldn8 A G 16: 88,359,829 (GRCm39) V32A probably damaging Het
Col4a4 G T 1: 82,484,780 (GRCm39) P496T unknown Het
Cyp27a1 T A 1: 74,776,236 (GRCm39) N417K probably benign Het
Dnah7a T C 1: 53,682,621 (GRCm39) D283G probably benign Het
Efcab3 A G 11: 104,933,627 (GRCm39) K4878E probably damaging Het
Elp1 A T 4: 56,774,737 (GRCm39) M746K probably damaging Het
Fmn1 T A 2: 113,195,967 (GRCm39) Y556N unknown Het
Fsip2 T C 2: 82,816,120 (GRCm39) I3951T possibly damaging Het
Gigyf1 C T 5: 137,522,581 (GRCm39) T773I probably damaging Het
Heatr6 A T 11: 83,672,189 (GRCm39) K1066* probably null Het
Mdfic T C 6: 15,741,070 (GRCm39) S142P possibly damaging Het
Mettl16 A G 11: 74,707,852 (GRCm39) I389V probably benign Het
Mia3 T C 1: 183,125,760 (GRCm39) Y57C probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nup160 T C 2: 90,544,239 (GRCm39) probably null Het
Or1e1 T C 11: 73,244,744 (GRCm39) L55P probably damaging Het
Or2n1e A G 17: 38,586,602 (GRCm39) *313W probably null Het
Or52a24 T A 7: 103,382,015 (GRCm39) V294D probably damaging Het
Or8b1b T A 9: 38,376,211 (GRCm39) S291R probably damaging Het
Or9s13 T A 1: 92,548,029 (GRCm39) C134S probably damaging Het
Pierce1 A T 2: 28,352,369 (GRCm39) N131K probably damaging Het
Plcxd1 A T 5: 110,251,422 (GRCm39) I333F probably damaging Het
Plxna2 C A 1: 194,493,270 (GRCm39) S1848R probably damaging Het
Plxna2 AT A 1: 194,476,172 (GRCm39) probably null Het
Pnpla2 T A 7: 141,037,406 (GRCm39) D136E probably benign Het
Polr1b T A 2: 128,950,014 (GRCm39) F245I probably damaging Het
Prmt9 T A 8: 78,287,594 (GRCm39) I245N probably damaging Het
Serhl A T 15: 82,986,073 (GRCm39) D62V probably damaging Het
Sh3rf3 A T 10: 58,842,925 (GRCm39) D297V probably damaging Het
Spata13 C T 14: 60,993,679 (GRCm39) R1044* probably null Het
Strbp G A 2: 37,530,906 (GRCm39) T116I probably benign Het
Supt5 T C 7: 28,015,224 (GRCm39) D977G probably benign Het
Tmem184c A G 8: 78,329,532 (GRCm39) V176A possibly damaging Het
Uhrf2 A G 19: 30,063,660 (GRCm39) N541S probably damaging Het
Vmn2r24 T A 6: 123,755,949 (GRCm39) F7Y possibly damaging Het
Vmn2r27 T C 6: 124,169,040 (GRCm39) R697G probably benign Het
Zfp994 A G 17: 22,421,761 (GRCm39) V18A probably damaging Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64,386,689 (GRCm39) missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64,395,574 (GRCm39) splice site probably benign
IGL02218:Apba2 APN 7 64,345,425 (GRCm39) missense probably benign 0.01
IGL02343:Apba2 APN 7 64,344,894 (GRCm39) missense probably damaging 0.96
IGL03265:Apba2 APN 7 64,345,071 (GRCm39) missense probably damaging 1.00
guadalupe UTSW 7 64,399,912 (GRCm39) missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64,271,908 (GRCm39) intron probably benign
R0395:Apba2 UTSW 7 64,393,156 (GRCm39) missense probably benign 0.00
R0554:Apba2 UTSW 7 64,395,528 (GRCm39) missense probably damaging 1.00
R0624:Apba2 UTSW 7 64,364,263 (GRCm39) splice site probably null
R0733:Apba2 UTSW 7 64,399,912 (GRCm39) missense probably damaging 1.00
R1107:Apba2 UTSW 7 64,395,467 (GRCm39) missense possibly damaging 0.51
R1464:Apba2 UTSW 7 64,345,297 (GRCm39) missense probably benign
R1464:Apba2 UTSW 7 64,345,297 (GRCm39) missense probably benign
R1486:Apba2 UTSW 7 64,386,696 (GRCm39) missense probably damaging 1.00
R1895:Apba2 UTSW 7 64,394,378 (GRCm39) critical splice donor site probably null
R1942:Apba2 UTSW 7 64,345,218 (GRCm39) missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64,394,378 (GRCm39) critical splice donor site probably null
R2002:Apba2 UTSW 7 64,383,290 (GRCm39) missense probably damaging 0.97
R2089:Apba2 UTSW 7 64,345,341 (GRCm39) missense probably benign 0.02
R2091:Apba2 UTSW 7 64,345,341 (GRCm39) missense probably benign 0.02
R2091:Apba2 UTSW 7 64,345,341 (GRCm39) missense probably benign 0.02
R2571:Apba2 UTSW 7 64,395,498 (GRCm39) missense probably damaging 0.98
R3035:Apba2 UTSW 7 64,389,540 (GRCm39) missense probably benign 0.03
R4620:Apba2 UTSW 7 64,364,215 (GRCm39) missense probably damaging 1.00
R5468:Apba2 UTSW 7 64,395,510 (GRCm39) missense probably damaging 1.00
R5478:Apba2 UTSW 7 64,344,934 (GRCm39) nonsense probably null
R5644:Apba2 UTSW 7 64,365,259 (GRCm39) missense probably benign
R5645:Apba2 UTSW 7 64,345,554 (GRCm39) missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64,395,464 (GRCm39) missense probably benign 0.03
R5969:Apba2 UTSW 7 64,394,195 (GRCm39) nonsense probably null
R6190:Apba2 UTSW 7 64,389,628 (GRCm39) missense probably damaging 0.98
R6806:Apba2 UTSW 7 64,345,207 (GRCm39) missense probably damaging 1.00
R7098:Apba2 UTSW 7 64,386,696 (GRCm39) missense probably damaging 1.00
R7143:Apba2 UTSW 7 64,394,165 (GRCm39) missense probably damaging 1.00
R7183:Apba2 UTSW 7 64,383,293 (GRCm39) missense probably benign 0.11
R7260:Apba2 UTSW 7 64,389,493 (GRCm39) missense probably damaging 1.00
R7479:Apba2 UTSW 7 64,389,607 (GRCm39) missense possibly damaging 0.63
R7677:Apba2 UTSW 7 64,344,845 (GRCm39) missense probably benign 0.02
R8325:Apba2 UTSW 7 64,345,730 (GRCm39) missense probably benign 0.02
R8376:Apba2 UTSW 7 64,345,341 (GRCm39) missense probably benign 0.02
R8411:Apba2 UTSW 7 64,386,674 (GRCm39) missense probably damaging 0.99
R8412:Apba2 UTSW 7 64,395,546 (GRCm39) missense probably damaging 1.00
R8857:Apba2 UTSW 7 64,399,939 (GRCm39) missense possibly damaging 0.76
R9040:Apba2 UTSW 7 64,393,072 (GRCm39) missense possibly damaging 0.82
R9265:Apba2 UTSW 7 64,393,020 (GRCm39) missense probably damaging 0.99
R9356:Apba2 UTSW 7 64,345,421 (GRCm39) missense probably damaging 1.00
R9569:Apba2 UTSW 7 64,393,138 (GRCm39) missense possibly damaging 0.64
R9667:Apba2 UTSW 7 64,345,062 (GRCm39) missense possibly damaging 0.67
Z1177:Apba2 UTSW 7 64,399,983 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAGCTACCAGGACTATTACCCC -3'
(R):5'- CCTGGAGGTAGTTAAGGCATACC -3'

Sequencing Primer
(F):5'- ACCAATGGGAACACAGGT -3'
(R):5'- ATACCTGCTCTTGGGGCCAC -3'
Posted On 2020-09-15