Mutagenetix > Incidental Mutation

Incidental Mutation 'R7960:Pik3c2b'

650023

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7960 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133103849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1509 (L1509Q)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: L1509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: L1509Q

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004F10Rik	T	C	7: 116,103,246	S82P	possibly damaging	Het
AA792892	A	G	5: 94,383,880	M208V	probably benign	Het
Ablim2	A	C	5: 35,857,149	E450A	probably benign	Het
Acacb	G	T	5: 114,230,861	M1713I	probably benign	Het
Acbd6	C	A	1: 155,687,020	Q256K	probably benign	Het
Agbl2	A	T	2: 90,791,631	N154I	probably benign	Het
Ahcyl2	A	G	6: 29,870,627	N181D	probably benign	Het
Aldh18a1	A	T	19: 40,557,820	D544E	probably benign	Het
Anapc1	A	T	2: 128,674,593	L407Q	probably damaging	Het
Arhgap26	T	A	18: 39,229,927	V34D		Het
Brd3	A	T	2: 27,452,933	S516T	probably benign	Het
Bsn	A	G	9: 108,115,548	S1002P	probably damaging	Het
C4b	G	T	17: 34,741,278		probably null	Het
Camta1	T	C	4: 151,148,533	T228A	probably benign	Het
Cct6b	T	C	11: 82,741,395	K256E	possibly damaging	Het
Cep85l	T	A	10: 53,296,307	Q552L	probably benign	Het
Col6a5	A	G	9: 105,945,850	F103L	unknown	Het
Copb2	A	G	9: 98,580,354	Q464R	possibly damaging	Het
Dlc1	G	T	8: 36,937,835	H267N	probably benign	Het
Dnajb2	T	C	1: 75,241,411	I184T		Het
Dnajc9	C	T	14: 20,388,696	E30K	possibly damaging	Het
Dock1	T	C	7: 135,077,188	L1012P	possibly damaging	Het
Dtnbp1	T	C	13: 44,953,174	K170R	probably benign	Het
F13b	T	A	1: 139,503,771	C26*	probably null	Het
Fam71a	T	A	1: 191,163,448	T333S	probably benign	Het
Ficd	G	T	5: 113,738,959	E398D	probably benign	Het
G6pc	G	A	11: 101,376,533	G270R	probably damaging	Het
Gm3604	T	C	13: 62,369,773	Y257C	probably damaging	Het
Hmcn1	T	A	1: 150,655,855	Y3221F	probably damaging	Het
Hs3st3b1	C	T	11: 63,921,868	G7D	possibly damaging	Het
Htr3b	A	T	9: 48,945,552	S209T	probably benign	Het
Iglon5	T	A	7: 43,476,902	E192D	probably benign	Het
Inpp5f	A	G	7: 128,693,914		probably null	Het
Kif26b	T	A	1: 178,678,919	C187S	probably damaging	Het
Klhl11	A	G	11: 100,463,979	S339P	probably benign	Het
Klk14	G	A	7: 43,692,043	A40T	probably damaging	Het
Kmt2c	G	A	5: 25,315,196	T1972I	probably benign	Het
Lama2	T	C	10: 26,993,098	T2784A	probably benign	Het
Loxhd1	T	A	18: 77,385,050	F1088I	probably damaging	Het
Map2k2	G	A	10: 81,119,134	R185Q	probably benign	Het
Mbd5	G	A	2: 49,279,784		probably null	Het
Mdc1	A	T	17: 35,850,678	R828*	probably null	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	A	G	2: 85,648,073	S83P	possibly damaging	Het
Parp4	C	A	14: 56,595,251		probably null	Het
Pbk	T	A	14: 65,809,201		probably null	Het
Phip	A	T	9: 82,893,348	D1060E	probably benign	Het
Pik3r5	T	A	11: 68,495,970	F808L	probably benign	Het
Plcl1	T	A	1: 55,697,284	S595T	possibly damaging	Het
Plxna2	AT	A	1: 194,793,864		probably null	Het
Pole	A	G	5: 110,289,861	K95R	possibly damaging	Het
Poteg	A	G	8: 27,456,860	T259A	probably benign	Het
Ptpn12	G	T	5: 21,055,689	P20Q	probably benign	Het
Ptpn5	T	A	7: 47,079,547	T440S	possibly damaging	Het
Ptpru	T	C	4: 131,788,509	R845G	probably benign	Het
Rasgrp2	G	T	19: 6,414,809	V596L	probably benign	Het
Rcbtb2	T	G	14: 73,161,944	V16G	probably benign	Het
Rel	T	C	11: 23,744,493	N289S	probably damaging	Het
Rpn1	T	A	6: 88,102,086	Y504N	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Scaf8	G	A	17: 3,171,122	V295M	unknown	Het
Slc25a48	T	A	13: 56,463,598	Y173N	probably damaging	Het
Slc8a3	C	T	12: 81,216,732	S627N	probably benign	Het
Snx8	T	A	5: 140,358,093	M123L	probably benign	Het
Sri	A	T	5: 8,064,586	Q180H	probably benign	Het
Sycp2	T	A	2: 178,404,660	R4S	probably null	Het
Tcstv1	G	A	13: 119,893,985	T37I	possibly damaging	Het
Tnnc2	A	T	2: 164,777,784	D87E	probably benign	Het
Trim7	A	T	11: 48,837,801	N92I	probably damaging	Het
Trpv6	C	T	6: 41,627,678	D97N	probably benign	Het
Ttc30a1	A	T	2: 75,980,844	D298E	probably benign	Het
Ttc37	T	C	13: 76,112,199	C87R	probably benign	Het
Ulk4	A	G	9: 121,272,956	Y19H	probably damaging	Het
Vmn2r69	C	T	7: 85,406,765	V722I	probably benign	Het
Zan	T	C	5: 137,409,603	D3643G	unknown	Het
Zan	G	A	5: 137,464,892	T675I	unknown	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTCTAGAGCACCTGAGAATCAG -3'
(R):5'- TGCCTGAATTGCCTGGTCAG -3'

Sequencing Primer
(F):5'- TCAGAAACCTGACAGGCCGG -3'
(R):5'- CTGCGGTGGAGGCTCAATAAATTTC -3'

Posted On

2020-09-15