Incidental Mutation 'R7960:Pik3c2b'
ID 650023
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 046004-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R7960 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133031587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1509 (L1509Q)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: L1509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: L1509Q

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 115,702,481 (GRCm39) S82P possibly damaging Het
Ablim2 A C 5: 36,014,493 (GRCm39) E450A probably benign Het
Acacb G T 5: 114,368,922 (GRCm39) M1713I probably benign Het
Acbd6 C A 1: 155,562,766 (GRCm39) Q256K probably benign Het
Agbl2 A T 2: 90,621,975 (GRCm39) N154I probably benign Het
Ahcyl2 A G 6: 29,870,626 (GRCm39) N181D probably benign Het
Aldh18a1 A T 19: 40,546,264 (GRCm39) D544E probably benign Het
Anapc1 A T 2: 128,516,513 (GRCm39) L407Q probably damaging Het
Arhgap26 T A 18: 39,362,980 (GRCm39) V34D Het
Brd3 A T 2: 27,342,945 (GRCm39) S516T probably benign Het
Bsn A G 9: 107,992,747 (GRCm39) S1002P probably damaging Het
C4b G T 17: 34,960,252 (GRCm39) probably null Het
Camta1 T C 4: 151,232,990 (GRCm39) T228A probably benign Het
Cct6b T C 11: 82,632,221 (GRCm39) K256E possibly damaging Het
Cep85l T A 10: 53,172,403 (GRCm39) Q552L probably benign Het
Col6a5 A G 9: 105,823,049 (GRCm39) F103L unknown Het
Copb2 A G 9: 98,462,407 (GRCm39) Q464R possibly damaging Het
Dlc1 G T 8: 37,404,989 (GRCm39) H267N probably benign Het
Dnajb2 T C 1: 75,218,055 (GRCm39) I184T Het
Dnajc9 C T 14: 20,438,764 (GRCm39) E30K possibly damaging Het
Dock1 T C 7: 134,678,917 (GRCm39) L1012P possibly damaging Het
Dtnbp1 T C 13: 45,106,650 (GRCm39) K170R probably benign Het
F13b T A 1: 139,431,509 (GRCm39) C26* probably null Het
Ficd G T 5: 113,877,020 (GRCm39) E398D probably benign Het
G6pc1 G A 11: 101,267,359 (GRCm39) G270R probably damaging Het
Garin4 T A 1: 190,895,645 (GRCm39) T333S probably benign Het
Gm3604 T C 13: 62,517,587 (GRCm39) Y257C probably damaging Het
Hmcn1 T A 1: 150,531,606 (GRCm39) Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,812,694 (GRCm39) G7D possibly damaging Het
Htr3b A T 9: 48,856,852 (GRCm39) S209T probably benign Het
Ift70a1 A T 2: 75,811,188 (GRCm39) D298E probably benign Het
Iglon5 T A 7: 43,126,326 (GRCm39) E192D probably benign Het
Inpp5f A G 7: 128,295,638 (GRCm39) probably null Het
Kif26b T A 1: 178,506,484 (GRCm39) C187S probably damaging Het
Klhl11 A G 11: 100,354,805 (GRCm39) S339P probably benign Het
Klk14 G A 7: 43,341,467 (GRCm39) A40T probably damaging Het
Kmt2c G A 5: 25,520,194 (GRCm39) T1972I probably benign Het
Lama2 T C 10: 26,869,094 (GRCm39) T2784A probably benign Het
Loxhd1 T A 18: 77,472,746 (GRCm39) F1088I probably damaging Het
Map2k2 G A 10: 80,954,968 (GRCm39) R185Q probably benign Het
Mbd5 G A 2: 49,169,796 (GRCm39) probably null Het
Mdc1 A T 17: 36,161,570 (GRCm39) R828* probably null Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Or5g25 A G 2: 85,478,417 (GRCm39) S83P possibly damaging Het
Parp4 C A 14: 56,832,708 (GRCm39) probably null Het
Pbk T A 14: 66,046,650 (GRCm39) probably null Het
Phip A T 9: 82,775,401 (GRCm39) D1060E probably benign Het
Pik3r5 T A 11: 68,386,796 (GRCm39) F808L probably benign Het
Plcl1 T A 1: 55,736,443 (GRCm39) S595T possibly damaging Het
Plxna2 AT A 1: 194,476,172 (GRCm39) probably null Het
Pole A G 5: 110,437,727 (GRCm39) K95R possibly damaging Het
Poteg A G 8: 27,946,888 (GRCm39) T259A probably benign Het
Pramel52-ps A G 5: 94,531,739 (GRCm39) M208V probably benign Het
Ptpn12 G T 5: 21,260,687 (GRCm39) P20Q probably benign Het
Ptpn5 T A 7: 46,729,295 (GRCm39) T440S possibly damaging Het
Ptpru T C 4: 131,515,820 (GRCm39) R845G probably benign Het
Rasgrp2 G T 19: 6,464,839 (GRCm39) V596L probably benign Het
Rcbtb2 T G 14: 73,399,384 (GRCm39) V16G probably benign Het
Rel T C 11: 23,694,493 (GRCm39) N289S probably damaging Het
Rpn1 T A 6: 88,079,068 (GRCm39) Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,124 (GRCm39) probably benign Het
Scaf8 G A 17: 3,221,397 (GRCm39) V295M unknown Het
Skic3 T C 13: 76,260,318 (GRCm39) C87R probably benign Het
Slc25a48 T A 13: 56,611,411 (GRCm39) Y173N probably damaging Het
Slc8a3 C T 12: 81,263,506 (GRCm39) S627N probably benign Het
Snx8 T A 5: 140,343,848 (GRCm39) M123L probably benign Het
Sri A T 5: 8,114,586 (GRCm39) Q180H probably benign Het
Sycp2 T A 2: 178,046,453 (GRCm39) R4S probably null Het
Tcstv1a G A 13: 120,355,521 (GRCm39) T37I possibly damaging Het
Tnnc2 A T 2: 164,619,704 (GRCm39) D87E probably benign Het
Trim7 A T 11: 48,728,628 (GRCm39) N92I probably damaging Het
Trpv6 C T 6: 41,604,612 (GRCm39) D97N probably benign Het
Ulk4 A G 9: 121,102,022 (GRCm39) Y19H probably damaging Het
Vmn2r69 C T 7: 85,055,973 (GRCm39) V722I probably benign Het
Zan T C 5: 137,407,865 (GRCm39) D3643G unknown Het
Zan G A 5: 137,463,154 (GRCm39) T675I unknown Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTAGAGCACCTGAGAATCAG -3'
(R):5'- TGCCTGAATTGCCTGGTCAG -3'

Sequencing Primer
(F):5'- TCAGAAACCTGACAGGCCGG -3'
(R):5'- CTGCGGTGGAGGCTCAATAAATTTC -3'
Posted On 2020-09-15