Incidental Mutation 'R7960:Sri'
ID 650040
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Name sorcin
Synonyms Sor, 2210417O06Rik, 2900070H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock # R7960 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 8046078-8069379 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8064586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 180 (Q180H)
Ref Sequence ENSEMBL: ENSMUSP00000118221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
AlphaFold Q6P069
Predicted Effect probably benign
Transcript: ENSMUST00000088786
AA Change: Q165H

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161
AA Change: Q165H

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148633
AA Change: Q180H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161
AA Change: Q180H

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,103,246 S82P possibly damaging Het
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
G6pc G A 11: 101,376,533 G270R probably damaging Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Pole A G 5: 110,289,861 K95R possibly damaging Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Slc8a3 C T 12: 81,216,732 S627N probably benign Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0847:Sri UTSW 5 8063755 splice site probably null
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R1187:Sri UTSW 5 8059416 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R3844:Sri UTSW 5 8064576 missense probably damaging 1.00
R4345:Sri UTSW 5 8059427 splice site probably null
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 splice site probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
R7716:Sri UTSW 5 8056641 critical splice donor site probably null
R7917:Sri UTSW 5 8063409 critical splice donor site probably null
R7929:Sri UTSW 5 8057652 intron probably benign
R8316:Sri UTSW 5 8063317 missense probably damaging 0.96
R9062:Sri UTSW 5 8056625 missense unknown
R9224:Sri UTSW 5 8063323 missense probably damaging 1.00
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAATGACCATTGACCACTTTCGG -3'
(R):5'- ATGAGCCACCATGTCCTATTATG -3'

Sequencing Primer
(F):5'- TCGGTCACTGTTACATATTGACTAG -3'
(R):5'- GTTTTAGGCAGAGTCTCACAAGC -3'
Posted On 2020-09-15