Mutagenetix > Incidental Mutation

Incidental Mutation 'R7960:Kmt2c'

650042

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

046004-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7960 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25315196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1972 (T1972I)

Ref Sequence

ENSEMBL: ENSMUSP00000043874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045291
AA Change: T1972I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: T1972I

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173073

SMART Domains

Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	858	870	1.41e2	SMART
PHD	913	962	2.89e-10	SMART
RING	914	961	4.74e0	SMART
C1	954	1005	8.38e-2	SMART
PHD	963	1009	1.05e-12	SMART
PHD	1040	1091	2.08e-2	SMART
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1297	1308	N/A	INTRINSIC
low complexity region	1354	1366	N/A	INTRINSIC
low complexity region	1445	1464	N/A	INTRINSIC
low complexity region	1482	1495	N/A	INTRINSIC
HMG	1564	1628	2.64e-3	SMART
low complexity region	1633	1649	N/A	INTRINSIC
coiled coil region	1670	1714	N/A	INTRINSIC

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004F10Rik	T	C	7: 116,103,246	S82P	possibly damaging	Het
AA792892	A	G	5: 94,383,880	M208V	probably benign	Het
Ablim2	A	C	5: 35,857,149	E450A	probably benign	Het
Acacb	G	T	5: 114,230,861	M1713I	probably benign	Het
Acbd6	C	A	1: 155,687,020	Q256K	probably benign	Het
Agbl2	A	T	2: 90,791,631	N154I	probably benign	Het
Ahcyl2	A	G	6: 29,870,627	N181D	probably benign	Het
Aldh18a1	A	T	19: 40,557,820	D544E	probably benign	Het
Anapc1	A	T	2: 128,674,593	L407Q	probably damaging	Het
Arhgap26	T	A	18: 39,229,927	V34D		Het
Brd3	A	T	2: 27,452,933	S516T	probably benign	Het
Bsn	A	G	9: 108,115,548	S1002P	probably damaging	Het
C4b	G	T	17: 34,741,278		probably null	Het
Camta1	T	C	4: 151,148,533	T228A	probably benign	Het
Cct6b	T	C	11: 82,741,395	K256E	possibly damaging	Het
Cep85l	T	A	10: 53,296,307	Q552L	probably benign	Het
Col6a5	A	G	9: 105,945,850	F103L	unknown	Het
Copb2	A	G	9: 98,580,354	Q464R	possibly damaging	Het
Dlc1	G	T	8: 36,937,835	H267N	probably benign	Het
Dnajb2	T	C	1: 75,241,411	I184T		Het
Dnajc9	C	T	14: 20,388,696	E30K	possibly damaging	Het
Dock1	T	C	7: 135,077,188	L1012P	possibly damaging	Het
Dtnbp1	T	C	13: 44,953,174	K170R	probably benign	Het
F13b	T	A	1: 139,503,771	C26*	probably null	Het
Fam71a	T	A	1: 191,163,448	T333S	probably benign	Het
Ficd	G	T	5: 113,738,959	E398D	probably benign	Het
G6pc	G	A	11: 101,376,533	G270R	probably damaging	Het
Gm3604	T	C	13: 62,369,773	Y257C	probably damaging	Het
Hmcn1	T	A	1: 150,655,855	Y3221F	probably damaging	Het
Hs3st3b1	C	T	11: 63,921,868	G7D	possibly damaging	Het
Htr3b	A	T	9: 48,945,552	S209T	probably benign	Het
Iglon5	T	A	7: 43,476,902	E192D	probably benign	Het
Inpp5f	A	G	7: 128,693,914		probably null	Het
Kif26b	T	A	1: 178,678,919	C187S	probably damaging	Het
Klhl11	A	G	11: 100,463,979	S339P	probably benign	Het
Klk14	G	A	7: 43,692,043	A40T	probably damaging	Het
Lama2	T	C	10: 26,993,098	T2784A	probably benign	Het
Loxhd1	T	A	18: 77,385,050	F1088I	probably damaging	Het
Map2k2	G	A	10: 81,119,134	R185Q	probably benign	Het
Mbd5	G	A	2: 49,279,784		probably null	Het
Mdc1	A	T	17: 35,850,678	R828*	probably null	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	A	G	2: 85,648,073	S83P	possibly damaging	Het
Parp4	C	A	14: 56,595,251		probably null	Het
Pbk	T	A	14: 65,809,201		probably null	Het
Phip	A	T	9: 82,893,348	D1060E	probably benign	Het
Pik3c2b	T	A	1: 133,103,849	L1509Q	probably damaging	Het
Pik3r5	T	A	11: 68,495,970	F808L	probably benign	Het
Plcl1	T	A	1: 55,697,284	S595T	possibly damaging	Het
Plxna2	AT	A	1: 194,793,864		probably null	Het
Pole	A	G	5: 110,289,861	K95R	possibly damaging	Het
Poteg	A	G	8: 27,456,860	T259A	probably benign	Het
Ptpn12	G	T	5: 21,055,689	P20Q	probably benign	Het
Ptpn5	T	A	7: 47,079,547	T440S	possibly damaging	Het
Ptpru	T	C	4: 131,788,509	R845G	probably benign	Het
Rasgrp2	G	T	19: 6,414,809	V596L	probably benign	Het
Rcbtb2	T	G	14: 73,161,944	V16G	probably benign	Het
Rel	T	C	11: 23,744,493	N289S	probably damaging	Het
Rpn1	T	A	6: 88,102,086	Y504N	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Scaf8	G	A	17: 3,171,122	V295M	unknown	Het
Slc25a48	T	A	13: 56,463,598	Y173N	probably damaging	Het
Slc8a3	C	T	12: 81,216,732	S627N	probably benign	Het
Snx8	T	A	5: 140,358,093	M123L	probably benign	Het
Sri	A	T	5: 8,064,586	Q180H	probably benign	Het
Sycp2	T	A	2: 178,404,660	R4S	probably null	Het
Tcstv1	G	A	13: 119,893,985	T37I	possibly damaging	Het
Tnnc2	A	T	2: 164,777,784	D87E	probably benign	Het
Trim7	A	T	11: 48,837,801	N92I	probably damaging	Het
Trpv6	C	T	6: 41,627,678	D97N	probably benign	Het
Ttc30a1	A	T	2: 75,980,844	D298E	probably benign	Het
Ttc37	T	C	13: 76,112,199	C87R	probably benign	Het
Ulk4	A	G	9: 121,272,956	Y19H	probably damaging	Het
Vmn2r69	C	T	7: 85,406,765	V722I	probably benign	Het
Zan	T	C	5: 137,409,603	D3643G	unknown	Het
Zan	G	A	5: 137,464,892	T675I	unknown	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
PIT4520001:Kmt2c	UTSW	5	25315666	missense	probably benign	0.12
PIT4585001:Kmt2c	UTSW	5	25315106	missense	probably benign	0.21
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0616:Kmt2c	UTSW	5	25299252	missense	probably benign
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1110:Kmt2c	UTSW	5	25314362	missense	probably benign	0.01
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2079:Kmt2c	UTSW	5	25352280	missense	possibly damaging	0.82
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5093:Kmt2c	UTSW	5	25409207	missense	probably benign	0.17
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
R7150:Kmt2c	UTSW	5	25300362	missense	possibly damaging	0.89
R7220:Kmt2c	UTSW	5	25344925	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25299491	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25309807	missense	probably benign	0.00
R7402:Kmt2c	UTSW	5	25395420	missense	probably damaging	1.00
R7465:Kmt2c	UTSW	5	25302849	missense	probably damaging	1.00
R7467:Kmt2c	UTSW	5	25308532	missense	probably damaging	1.00
R7491:Kmt2c	UTSW	5	25284564	missense	probably damaging	0.99
R7549:Kmt2c	UTSW	5	25414970	missense	possibly damaging	0.95
R7637:Kmt2c	UTSW	5	25315095	missense	probably damaging	1.00
R7652:Kmt2c	UTSW	5	25315719	missense	probably benign	0.01
R7714:Kmt2c	UTSW	5	25375366	missense	probably benign
R7838:Kmt2c	UTSW	5	25294699	missense	possibly damaging	0.57
R7891:Kmt2c	UTSW	5	25300111	missense	probably damaging	1.00
R7892:Kmt2c	UTSW	5	25299816	missense	probably benign	0.18
R7895:Kmt2c	UTSW	5	25373176	missense	possibly damaging	0.65
R7974:Kmt2c	UTSW	5	25300563	missense	probably damaging	1.00
R7978:Kmt2c	UTSW	5	25359678	missense	probably benign	0.00
R8011:Kmt2c	UTSW	5	25351234	missense	probably damaging	0.99
R8021:Kmt2c	UTSW	5	25287119	missense	possibly damaging	0.88
R8022:Kmt2c	UTSW	5	25281680	missense	possibly damaging	0.83
R8079:Kmt2c	UTSW	5	25302732	missense	probably damaging	0.98
R8087:Kmt2c	UTSW	5	25329252	missense	probably damaging	1.00
R8109:Kmt2c	UTSW	5	25281384	missense	probably damaging	1.00
R8161:Kmt2c	UTSW	5	25374564	missense	probably benign	0.00
R8169:Kmt2c	UTSW	5	25354687	missense	probably damaging	1.00
R8206:Kmt2c	UTSW	5	25314539	missense	probably damaging	0.98
R8218:Kmt2c	UTSW	5	25283106	missense	probably damaging	1.00
R8223:Kmt2c	UTSW	5	25324218	missense	possibly damaging	0.89
R8260:Kmt2c	UTSW	5	25405516	missense	possibly damaging	0.87
R8330:Kmt2c	UTSW	5	25304694	missense	probably null	1.00
R8355:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8455:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8508:Kmt2c	UTSW	5	25314122	missense	probably benign	0.34
R8885:Kmt2c	UTSW	5	25315079	missense	probably benign	0.34
R8907:Kmt2c	UTSW	5	25309611	missense	probably damaging	1.00
R8924:Kmt2c	UTSW	5	25298887	missense	probably benign
R8969:Kmt2c	UTSW	5	25314389	missense	possibly damaging	0.82
R9019:Kmt2c	UTSW	5	25283210	missense	probably damaging	1.00
R9035:Kmt2c	UTSW	5	25319012	missense	probably damaging	1.00
R9074:Kmt2c	UTSW	5	25284345	missense	probably damaging	1.00
R9125:Kmt2c	UTSW	5	25284196	missense	possibly damaging	0.86
R9130:Kmt2c	UTSW	5	25311104	missense	probably benign	0.01
R9171:Kmt2c	UTSW	5	25281311	missense	probably damaging	1.00
R9235:Kmt2c	UTSW	5	25299999	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9336:Kmt2c	UTSW	5	25409167	missense	probably benign	0.06
R9443:Kmt2c	UTSW	5	25310047	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9526:Kmt2c	UTSW	5	25281357	missense	probably damaging	1.00
R9653:Kmt2c	UTSW	5	25302821	missense	probably damaging	1.00
R9729:Kmt2c	UTSW	5	25284760	missense	probably damaging	1.00
R9731:Kmt2c	UTSW	5	25372958	missense	probably benign	0.18
R9784:Kmt2c	UTSW	5	25344961	missense	probably damaging	1.00
RF001:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF006:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF011:Kmt2c	UTSW	5	25338459	missense	probably damaging	1.00
RF041:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF047:Kmt2c	UTSW	5	25315760	small insertion	probably benign
RF051:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF055:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF059:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF063:Kmt2c	UTSW	5	25315764	small insertion	probably benign
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90
Z1176:Kmt2c	UTSW	5	25354413	missense	probably damaging	1.00
Z1177:Kmt2c	UTSW	5	25295397	critical splice donor site	probably null
Z1177:Kmt2c	UTSW	5	25300003	missense	probably benign	0.00
Z1177:Kmt2c	UTSW	5	25366197	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTGTCAATGACGGTCCTG -3'
(R):5'- AATGGTTGGTACTCCTAGACCACC -3'

Sequencing Primer
(F):5'- TCAATGACGGTCCTGCATAG -3'
(R):5'- CCTGGTGGACATAGTTTTCCAAGAAG -3'

Posted On

2020-09-15