Incidental Mutation 'R7960:Pole'
ID650045
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7960 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110289861 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 95 (K95R)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000031472] [ENSMUST00000112482] [ENSMUST00000155266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: K95R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: K95R

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031472
SMART Domains Protein: ENSMUSP00000031472
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Mpv17_PMP22 128 192 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112482
AA Change: K95R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080
AA Change: K95R

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155266
SMART Domains Protein: ENSMUSP00000117729
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
Meta Mutation Damage Score 0.1879 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,103,246 S82P possibly damaging Het
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
G6pc G A 11: 101,376,533 G270R probably damaging Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Slc8a3 C T 12: 81,216,732 S627N probably benign Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sri A T 5: 8,064,586 Q180H probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGTACTAGCTTCTCACAGG -3'
(R):5'- TGAGCAACCTGGACACAAGG -3'

Sequencing Primer
(F):5'- AGTACTAGCTTCTCACAGGGTAGC -3'
(R):5'- AAGGCGCCTTGGACCTTGATAG -3'
Posted On2020-09-15