Mutagenetix > Incidental Mutation

Incidental Mutation 'R7960:Acacb'

650047

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7960 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114230861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1713 (M1713I)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: M1713I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: M1713I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: M1713I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: M1713I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Meta Mutation Damage Score

0.1229

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004F10Rik	T	C	7: 116,103,246	S82P	possibly damaging	Het
AA792892	A	G	5: 94,383,880	M208V	probably benign	Het
Ablim2	A	C	5: 35,857,149	E450A	probably benign	Het
Acbd6	C	A	1: 155,687,020	Q256K	probably benign	Het
Agbl2	A	T	2: 90,791,631	N154I	probably benign	Het
Ahcyl2	A	G	6: 29,870,627	N181D	probably benign	Het
Aldh18a1	A	T	19: 40,557,820	D544E	probably benign	Het
Anapc1	A	T	2: 128,674,593	L407Q	probably damaging	Het
Arhgap26	T	A	18: 39,229,927	V34D		Het
Brd3	A	T	2: 27,452,933	S516T	probably benign	Het
Bsn	A	G	9: 108,115,548	S1002P	probably damaging	Het
C4b	G	T	17: 34,741,278		probably null	Het
Camta1	T	C	4: 151,148,533	T228A	probably benign	Het
Cct6b	T	C	11: 82,741,395	K256E	possibly damaging	Het
Cep85l	T	A	10: 53,296,307	Q552L	probably benign	Het
Col6a5	A	G	9: 105,945,850	F103L	unknown	Het
Copb2	A	G	9: 98,580,354	Q464R	possibly damaging	Het
Dlc1	G	T	8: 36,937,835	H267N	probably benign	Het
Dnajb2	T	C	1: 75,241,411	I184T		Het
Dnajc9	C	T	14: 20,388,696	E30K	possibly damaging	Het
Dock1	T	C	7: 135,077,188	L1012P	possibly damaging	Het
Dtnbp1	T	C	13: 44,953,174	K170R	probably benign	Het
F13b	T	A	1: 139,503,771	C26*	probably null	Het
Fam71a	T	A	1: 191,163,448	T333S	probably benign	Het
Ficd	G	T	5: 113,738,959	E398D	probably benign	Het
G6pc	G	A	11: 101,376,533	G270R	probably damaging	Het
Gm3604	T	C	13: 62,369,773	Y257C	probably damaging	Het
Hmcn1	T	A	1: 150,655,855	Y3221F	probably damaging	Het
Hs3st3b1	C	T	11: 63,921,868	G7D	possibly damaging	Het
Htr3b	A	T	9: 48,945,552	S209T	probably benign	Het
Iglon5	T	A	7: 43,476,902	E192D	probably benign	Het
Inpp5f	A	G	7: 128,693,914		probably null	Het
Kif26b	T	A	1: 178,678,919	C187S	probably damaging	Het
Klhl11	A	G	11: 100,463,979	S339P	probably benign	Het
Klk14	G	A	7: 43,692,043	A40T	probably damaging	Het
Kmt2c	G	A	5: 25,315,196	T1972I	probably benign	Het
Lama2	T	C	10: 26,993,098	T2784A	probably benign	Het
Loxhd1	T	A	18: 77,385,050	F1088I	probably damaging	Het
Map2k2	G	A	10: 81,119,134	R185Q	probably benign	Het
Mbd5	G	A	2: 49,279,784		probably null	Het
Mdc1	A	T	17: 35,850,678	R828*	probably null	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	A	G	2: 85,648,073	S83P	possibly damaging	Het
Parp4	C	A	14: 56,595,251		probably null	Het
Pbk	T	A	14: 65,809,201		probably null	Het
Phip	A	T	9: 82,893,348	D1060E	probably benign	Het
Pik3c2b	T	A	1: 133,103,849	L1509Q	probably damaging	Het
Pik3r5	T	A	11: 68,495,970	F808L	probably benign	Het
Plcl1	T	A	1: 55,697,284	S595T	possibly damaging	Het
Plxna2	AT	A	1: 194,793,864		probably null	Het
Pole	A	G	5: 110,289,861	K95R	possibly damaging	Het
Poteg	A	G	8: 27,456,860	T259A	probably benign	Het
Ptpn12	G	T	5: 21,055,689	P20Q	probably benign	Het
Ptpn5	T	A	7: 47,079,547	T440S	possibly damaging	Het
Ptpru	T	C	4: 131,788,509	R845G	probably benign	Het
Rasgrp2	G	T	19: 6,414,809	V596L	probably benign	Het
Rcbtb2	T	G	14: 73,161,944	V16G	probably benign	Het
Rel	T	C	11: 23,744,493	N289S	probably damaging	Het
Rpn1	T	A	6: 88,102,086	Y504N	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Scaf8	G	A	17: 3,171,122	V295M	unknown	Het
Slc25a48	T	A	13: 56,463,598	Y173N	probably damaging	Het
Slc8a3	C	T	12: 81,216,732	S627N	probably benign	Het
Snx8	T	A	5: 140,358,093	M123L	probably benign	Het
Sri	A	T	5: 8,064,586	Q180H	probably benign	Het
Sycp2	T	A	2: 178,404,660	R4S	probably null	Het
Tcstv1	G	A	13: 119,893,985	T37I	possibly damaging	Het
Tnnc2	A	T	2: 164,777,784	D87E	probably benign	Het
Trim7	A	T	11: 48,837,801	N92I	probably damaging	Het
Trpv6	C	T	6: 41,627,678	D97N	probably benign	Het
Ttc30a1	A	T	2: 75,980,844	D298E	probably benign	Het
Ttc37	T	C	13: 76,112,199	C87R	probably benign	Het
Ulk4	A	G	9: 121,272,956	Y19H	probably damaging	Het
Vmn2r69	C	T	7: 85,406,765	V722I	probably benign	Het
Zan	T	C	5: 137,409,603	D3643G	unknown	Het
Zan	G	A	5: 137,464,892	T675I	unknown	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACTTTTGTTGCCAGGACTCAGG -3'
(R):5'- AAGTTCAATTTGTCTCGGGGAG -3'

Sequencing Primer
(F):5'- TGGGACTCAAACCTAGGTCC -3'
(R):5'- GAGAAAGTACCATGAAGTCAGTCATC -3'

Posted On

2020-09-15