Incidental Mutation 'R7960:Rsf1'
ID650058
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7960 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGGCGGCGG to CGGCGGCGGGGGCGGCGG at 97579917 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000178078] [ENSMUST00000154853]
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,103,246 S82P possibly damaging Het
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
G6pc G A 11: 101,376,533 G270R probably damaging Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Pole A G 5: 110,289,861 K95R possibly damaging Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Slc8a3 C T 12: 81,216,732 S627N probably benign Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sri A T 5: 8,064,586 Q180H probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97579909 unclassified probably benign
BB014:Rsf1 UTSW 7 97579924 unclassified probably benign
BB018:Rsf1 UTSW 7 97579909 unclassified probably benign
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
R7352:Rsf1 UTSW 7 97579926 unclassified probably benign
R7380:Rsf1 UTSW 7 97579915 unclassified probably benign
R7393:Rsf1 UTSW 7 97579917 unclassified probably benign
R7395:Rsf1 UTSW 7 97579926 unclassified probably benign
R7411:Rsf1 UTSW 7 97579932 unclassified probably benign
R7413:Rsf1 UTSW 7 97579921 unclassified probably benign
R7481:Rsf1 UTSW 7 97579917 unclassified probably benign
R7538:Rsf1 UTSW 7 97579906 unclassified probably benign
R7541:Rsf1 UTSW 7 97579911 unclassified probably benign
R7545:Rsf1 UTSW 7 97579927 unclassified probably benign
R7574:Rsf1 UTSW 7 97661167 missense
R7578:Rsf1 UTSW 7 97579932 unclassified probably benign
R7599:Rsf1 UTSW 7 97579904 unclassified probably benign
R7630:Rsf1 UTSW 7 97579906 unclassified probably benign
R7632:Rsf1 UTSW 7 97579906 unclassified probably benign
R7710:Rsf1 UTSW 7 97681834 missense
R7711:Rsf1 UTSW 7 97579909 unclassified probably benign
R7715:Rsf1 UTSW 7 97579912 unclassified probably benign
R7719:Rsf1 UTSW 7 97579906 unclassified probably benign
R7722:Rsf1 UTSW 7 97579906 unclassified probably benign
R7729:Rsf1 UTSW 7 97579911 unclassified probably benign
R7734:Rsf1 UTSW 7 97579908 unclassified probably benign
R7743:Rsf1 UTSW 7 97579932 unclassified probably benign
R7761:Rsf1 UTSW 7 97579920 unclassified probably benign
R7764:Rsf1 UTSW 7 97579927 unclassified probably benign
R7797:Rsf1 UTSW 7 97661485 missense
R7802:Rsf1 UTSW 7 97661772 missense
R7806:Rsf1 UTSW 7 97579920 unclassified probably benign
R7821:Rsf1 UTSW 7 97579906 unclassified probably benign
R7823:Rsf1 UTSW 7 97579907 unclassified probably benign
R7824:Rsf1 UTSW 7 97579908 unclassified probably benign
R7825:Rsf1 UTSW 7 97579909 unclassified probably benign
R7826:Rsf1 UTSW 7 97661161 unclassified probably benign
R7841:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R7854:Rsf1 UTSW 7 97579924 unclassified probably benign
R7862:Rsf1 UTSW 7 97579923 unclassified probably benign
R7893:Rsf1 UTSW 7 97661958 missense
R7923:Rsf1 UTSW 7 97579906 unclassified probably benign
R7924:Rsf1 UTSW 7 97579909 unclassified probably benign
R7927:Rsf1 UTSW 7 97579924 unclassified probably benign
R7931:Rsf1 UTSW 7 97579909 unclassified probably benign
R7951:Rsf1 UTSW 7 97579912 unclassified probably benign
R7957:Rsf1 UTSW 7 97579906 unclassified probably benign
R7979:Rsf1 UTSW 7 97685713 missense
R7982:Rsf1 UTSW 7 97579932 unclassified probably benign
R7991:Rsf1 UTSW 7 97661333 missense
R8028:Rsf1 UTSW 7 97579908 unclassified probably benign
R8030:Rsf1 UTSW 7 97579909 unclassified probably benign
R8042:Rsf1 UTSW 7 97579909 unclassified probably benign
R8062:Rsf1 UTSW 7 97677387 missense
R8076:Rsf1 UTSW 7 97579904 unclassified probably benign
R8117:Rsf1 UTSW 7 97639257 splice site probably null
R8132:Rsf1 UTSW 7 97579908 unclassified probably benign
R8153:Rsf1 UTSW 7 97579906 unclassified probably benign
R8155:Rsf1 UTSW 7 97579907 unclassified probably benign
R8166:Rsf1 UTSW 7 97579909 unclassified probably benign
R8197:Rsf1 UTSW 7 97579914 unclassified probably benign
R8235:Rsf1 UTSW 7 97676254 utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97579915 unclassified probably benign
R8282:Rsf1 UTSW 7 97579920 frame shift probably null
R8301:Rsf1 UTSW 7 97661925 missense
R8315:Rsf1 UTSW 7 97579923 unclassified probably benign
R8343:Rsf1 UTSW 7 97579904 unclassified probably benign
R8370:Rsf1 UTSW 7 97579929 unclassified probably benign
R8372:Rsf1 UTSW 7 97662417 missense
R8376:Rsf1 UTSW 7 97579917 unclassified probably benign
R8382:Rsf1 UTSW 7 97579917 unclassified probably benign
R8392:Rsf1 UTSW 7 97579909 unclassified probably benign
R8410:Rsf1 UTSW 7 97579917 unclassified probably benign
R8443:Rsf1 UTSW 7 97616896 missense
R8502:Rsf1 UTSW 7 97579914 unclassified probably benign
R8529:Rsf1 UTSW 7 97670867 utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97579914 unclassified probably benign
R8554:Rsf1 UTSW 7 97579923 unclassified probably benign
R8558:Rsf1 UTSW 7 97579907 unclassified probably benign
R8724:Rsf1 UTSW 7 97579920 unclassified probably benign
R8735:Rsf1 UTSW 7 97579907 unclassified probably benign
R8742:Rsf1 UTSW 7 97579914 unclassified probably benign
R8772:Rsf1 UTSW 7 97579908 unclassified probably benign
R8804:Rsf1 UTSW 7 97579926 unclassified probably benign
R8852:Rsf1 UTSW 7 97579915 unclassified probably benign
R8862:Rsf1 UTSW 7 97579907 unclassified probably benign
R8866:Rsf1 UTSW 7 97579913 unclassified probably benign
RF034:Rsf1 UTSW 7 97579908 unclassified probably benign
RF036:Rsf1 UTSW 7 97579908 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCGATCTAACTCAGTTCTCGAC -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On2020-09-15