Incidental Mutation 'R7960:Bsn'
ID 650067
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission 046004-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R7960 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107973221-108067583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107992747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1002 (S1002P)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: S1002P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: S1002P

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 115,702,481 (GRCm39) S82P possibly damaging Het
Ablim2 A C 5: 36,014,493 (GRCm39) E450A probably benign Het
Acacb G T 5: 114,368,922 (GRCm39) M1713I probably benign Het
Acbd6 C A 1: 155,562,766 (GRCm39) Q256K probably benign Het
Agbl2 A T 2: 90,621,975 (GRCm39) N154I probably benign Het
Ahcyl2 A G 6: 29,870,626 (GRCm39) N181D probably benign Het
Aldh18a1 A T 19: 40,546,264 (GRCm39) D544E probably benign Het
Anapc1 A T 2: 128,516,513 (GRCm39) L407Q probably damaging Het
Arhgap26 T A 18: 39,362,980 (GRCm39) V34D Het
Brd3 A T 2: 27,342,945 (GRCm39) S516T probably benign Het
C4b G T 17: 34,960,252 (GRCm39) probably null Het
Camta1 T C 4: 151,232,990 (GRCm39) T228A probably benign Het
Cct6b T C 11: 82,632,221 (GRCm39) K256E possibly damaging Het
Cep85l T A 10: 53,172,403 (GRCm39) Q552L probably benign Het
Col6a5 A G 9: 105,823,049 (GRCm39) F103L unknown Het
Copb2 A G 9: 98,462,407 (GRCm39) Q464R possibly damaging Het
Dlc1 G T 8: 37,404,989 (GRCm39) H267N probably benign Het
Dnajb2 T C 1: 75,218,055 (GRCm39) I184T Het
Dnajc9 C T 14: 20,438,764 (GRCm39) E30K possibly damaging Het
Dock1 T C 7: 134,678,917 (GRCm39) L1012P possibly damaging Het
Dtnbp1 T C 13: 45,106,650 (GRCm39) K170R probably benign Het
F13b T A 1: 139,431,509 (GRCm39) C26* probably null Het
Ficd G T 5: 113,877,020 (GRCm39) E398D probably benign Het
G6pc1 G A 11: 101,267,359 (GRCm39) G270R probably damaging Het
Garin4 T A 1: 190,895,645 (GRCm39) T333S probably benign Het
Gm3604 T C 13: 62,517,587 (GRCm39) Y257C probably damaging Het
Hmcn1 T A 1: 150,531,606 (GRCm39) Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,812,694 (GRCm39) G7D possibly damaging Het
Htr3b A T 9: 48,856,852 (GRCm39) S209T probably benign Het
Ift70a1 A T 2: 75,811,188 (GRCm39) D298E probably benign Het
Iglon5 T A 7: 43,126,326 (GRCm39) E192D probably benign Het
Inpp5f A G 7: 128,295,638 (GRCm39) probably null Het
Kif26b T A 1: 178,506,484 (GRCm39) C187S probably damaging Het
Klhl11 A G 11: 100,354,805 (GRCm39) S339P probably benign Het
Klk14 G A 7: 43,341,467 (GRCm39) A40T probably damaging Het
Kmt2c G A 5: 25,520,194 (GRCm39) T1972I probably benign Het
Lama2 T C 10: 26,869,094 (GRCm39) T2784A probably benign Het
Loxhd1 T A 18: 77,472,746 (GRCm39) F1088I probably damaging Het
Map2k2 G A 10: 80,954,968 (GRCm39) R185Q probably benign Het
Mbd5 G A 2: 49,169,796 (GRCm39) probably null Het
Mdc1 A T 17: 36,161,570 (GRCm39) R828* probably null Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Or5g25 A G 2: 85,478,417 (GRCm39) S83P possibly damaging Het
Parp4 C A 14: 56,832,708 (GRCm39) probably null Het
Pbk T A 14: 66,046,650 (GRCm39) probably null Het
Phip A T 9: 82,775,401 (GRCm39) D1060E probably benign Het
Pik3c2b T A 1: 133,031,587 (GRCm39) L1509Q probably damaging Het
Pik3r5 T A 11: 68,386,796 (GRCm39) F808L probably benign Het
Plcl1 T A 1: 55,736,443 (GRCm39) S595T possibly damaging Het
Plxna2 AT A 1: 194,476,172 (GRCm39) probably null Het
Pole A G 5: 110,437,727 (GRCm39) K95R possibly damaging Het
Poteg A G 8: 27,946,888 (GRCm39) T259A probably benign Het
Pramel52-ps A G 5: 94,531,739 (GRCm39) M208V probably benign Het
Ptpn12 G T 5: 21,260,687 (GRCm39) P20Q probably benign Het
Ptpn5 T A 7: 46,729,295 (GRCm39) T440S possibly damaging Het
Ptpru T C 4: 131,515,820 (GRCm39) R845G probably benign Het
Rasgrp2 G T 19: 6,464,839 (GRCm39) V596L probably benign Het
Rcbtb2 T G 14: 73,399,384 (GRCm39) V16G probably benign Het
Rel T C 11: 23,694,493 (GRCm39) N289S probably damaging Het
Rpn1 T A 6: 88,079,068 (GRCm39) Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,124 (GRCm39) probably benign Het
Scaf8 G A 17: 3,221,397 (GRCm39) V295M unknown Het
Skic3 T C 13: 76,260,318 (GRCm39) C87R probably benign Het
Slc25a48 T A 13: 56,611,411 (GRCm39) Y173N probably damaging Het
Slc8a3 C T 12: 81,263,506 (GRCm39) S627N probably benign Het
Snx8 T A 5: 140,343,848 (GRCm39) M123L probably benign Het
Sri A T 5: 8,114,586 (GRCm39) Q180H probably benign Het
Sycp2 T A 2: 178,046,453 (GRCm39) R4S probably null Het
Tcstv1a G A 13: 120,355,521 (GRCm39) T37I possibly damaging Het
Tnnc2 A T 2: 164,619,704 (GRCm39) D87E probably benign Het
Trim7 A T 11: 48,728,628 (GRCm39) N92I probably damaging Het
Trpv6 C T 6: 41,604,612 (GRCm39) D97N probably benign Het
Ulk4 A G 9: 121,102,022 (GRCm39) Y19H probably damaging Het
Vmn2r69 C T 7: 85,055,973 (GRCm39) V722I probably benign Het
Zan T C 5: 137,407,865 (GRCm39) D3643G unknown Het
Zan G A 5: 137,463,154 (GRCm39) T675I unknown Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 107,992,309 (GRCm39) missense probably benign 0.01
IGL00330:Bsn APN 9 107,992,539 (GRCm39) missense probably damaging 1.00
IGL00863:Bsn APN 9 107,992,521 (GRCm39) missense probably damaging 1.00
IGL01123:Bsn APN 9 107,993,185 (GRCm39) missense probably damaging 1.00
IGL01330:Bsn APN 9 107,988,112 (GRCm39) unclassified probably benign
IGL01336:Bsn APN 9 107,988,984 (GRCm39) missense probably damaging 0.99
IGL01399:Bsn APN 9 107,984,386 (GRCm39) missense unknown
IGL01683:Bsn APN 9 107,992,095 (GRCm39) missense possibly damaging 0.71
IGL02022:Bsn APN 9 107,987,617 (GRCm39) unclassified probably benign
IGL02396:Bsn APN 9 107,993,245 (GRCm39) missense possibly damaging 0.90
IGL02538:Bsn APN 9 107,982,435 (GRCm39) missense unknown
IGL02565:Bsn APN 9 107,990,487 (GRCm39) missense probably damaging 0.99
IGL02661:Bsn APN 9 107,984,135 (GRCm39) nonsense probably null
IGL02739:Bsn APN 9 107,989,745 (GRCm39) missense probably benign 0.14
IGL02951:Bsn APN 9 107,992,812 (GRCm39) missense probably damaging 1.00
IGL02987:Bsn APN 9 108,003,503 (GRCm39) missense probably benign 0.03
IGL03033:Bsn APN 9 107,993,192 (GRCm39) missense probably damaging 1.00
IGL03069:Bsn APN 9 107,991,462 (GRCm39) missense probably damaging 1.00
IGL03076:Bsn APN 9 107,982,581 (GRCm39) missense unknown
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0167:Bsn UTSW 9 108,003,185 (GRCm39) missense probably benign 0.01
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0359:Bsn UTSW 9 107,989,045 (GRCm39) missense possibly damaging 0.81
R0514:Bsn UTSW 9 108,002,981 (GRCm39) missense probably benign 0.07
R0593:Bsn UTSW 9 107,987,505 (GRCm39) missense unknown
R0617:Bsn UTSW 9 107,984,439 (GRCm39) missense unknown
R0636:Bsn UTSW 9 107,985,033 (GRCm39) missense unknown
R0652:Bsn UTSW 9 107,982,941 (GRCm39) missense unknown
R0718:Bsn UTSW 9 107,988,559 (GRCm39) unclassified probably benign
R0730:Bsn UTSW 9 107,984,011 (GRCm39) missense unknown
R0905:Bsn UTSW 9 107,982,834 (GRCm39) missense unknown
R0963:Bsn UTSW 9 107,989,006 (GRCm39) missense possibly damaging 0.81
R0992:Bsn UTSW 9 107,991,553 (GRCm39) nonsense probably null
R1101:Bsn UTSW 9 107,993,610 (GRCm39) missense probably damaging 1.00
R1393:Bsn UTSW 9 107,987,716 (GRCm39) unclassified probably benign
R1490:Bsn UTSW 9 107,991,193 (GRCm39) missense probably benign 0.03
R1566:Bsn UTSW 9 108,003,184 (GRCm39) missense probably benign 0.35
R1582:Bsn UTSW 9 107,982,291 (GRCm39) missense unknown
R1738:Bsn UTSW 9 107,984,133 (GRCm39) missense unknown
R1867:Bsn UTSW 9 107,983,918 (GRCm39) missense unknown
R1918:Bsn UTSW 9 107,984,772 (GRCm39) missense unknown
R1933:Bsn UTSW 9 107,993,643 (GRCm39) missense possibly damaging 0.91
R1946:Bsn UTSW 9 107,991,850 (GRCm39) missense probably damaging 0.99
R1978:Bsn UTSW 9 107,991,748 (GRCm39) missense probably benign 0.35
R2068:Bsn UTSW 9 108,003,749 (GRCm39) missense possibly damaging 0.95
R2068:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R2113:Bsn UTSW 9 107,992,085 (GRCm39) missense probably benign 0.14
R2136:Bsn UTSW 9 107,990,430 (GRCm39) missense probably damaging 1.00
R2172:Bsn UTSW 9 107,987,191 (GRCm39) intron probably benign
R2266:Bsn UTSW 9 107,992,323 (GRCm39) missense probably damaging 1.00
R2293:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2294:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2368:Bsn UTSW 9 107,988,229 (GRCm39) nonsense probably null
R2442:Bsn UTSW 9 107,984,119 (GRCm39) missense unknown
R2507:Bsn UTSW 9 107,993,313 (GRCm39) missense probably damaging 1.00
R2880:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2881:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2922:Bsn UTSW 9 107,992,668 (GRCm39) missense probably damaging 1.00
R2922:Bsn UTSW 9 107,985,385 (GRCm39) missense unknown
R3618:Bsn UTSW 9 107,994,760 (GRCm39) critical splice acceptor site probably null
R3742:Bsn UTSW 9 107,982,938 (GRCm39) missense unknown
R3825:Bsn UTSW 9 107,984,055 (GRCm39) missense unknown
R3982:Bsn UTSW 9 107,984,365 (GRCm39) missense unknown
R4094:Bsn UTSW 9 107,991,069 (GRCm39) missense probably damaging 1.00
R4158:Bsn UTSW 9 107,990,145 (GRCm39) missense possibly damaging 0.95
R4225:Bsn UTSW 9 107,983,932 (GRCm39) missense unknown
R4261:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R4482:Bsn UTSW 9 107,991,863 (GRCm39) missense probably damaging 1.00
R4515:Bsn UTSW 9 107,981,277 (GRCm39) splice site probably null
R4585:Bsn UTSW 9 107,987,662 (GRCm39) unclassified probably benign
R4628:Bsn UTSW 9 107,990,434 (GRCm39) missense probably damaging 1.00
R4636:Bsn UTSW 9 107,992,623 (GRCm39) missense probably damaging 1.00
R4679:Bsn UTSW 9 107,987,329 (GRCm39) missense unknown
R4723:Bsn UTSW 9 107,989,854 (GRCm39) missense probably benign 0.03
R4843:Bsn UTSW 9 107,984,388 (GRCm39) missense unknown
R4885:Bsn UTSW 9 107,984,726 (GRCm39) nonsense probably null
R4936:Bsn UTSW 9 107,988,960 (GRCm39) missense probably damaging 1.00
R4942:Bsn UTSW 9 107,983,678 (GRCm39) missense unknown
R4972:Bsn UTSW 9 107,992,377 (GRCm39) missense probably damaging 1.00
R4992:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R5067:Bsn UTSW 9 107,989,152 (GRCm39) missense probably damaging 1.00
R5206:Bsn UTSW 9 107,982,572 (GRCm39) missense unknown
R5286:Bsn UTSW 9 107,988,123 (GRCm39) unclassified probably benign
R5492:Bsn UTSW 9 107,989,714 (GRCm39) missense probably damaging 0.98
R5553:Bsn UTSW 9 107,987,620 (GRCm39) unclassified probably benign
R5561:Bsn UTSW 9 107,982,710 (GRCm39) missense unknown
R5597:Bsn UTSW 9 107,992,131 (GRCm39) missense probably benign 0.06
R5646:Bsn UTSW 9 107,987,631 (GRCm39) unclassified probably benign
R5796:Bsn UTSW 9 108,003,223 (GRCm39) missense probably damaging 1.00
R5801:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5802:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5850:Bsn UTSW 9 107,992,149 (GRCm39) missense probably damaging 0.99
R5938:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R6221:Bsn UTSW 9 107,982,765 (GRCm39) missense unknown
R6243:Bsn UTSW 9 107,984,760 (GRCm39) missense unknown
R6254:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.96
R6263:Bsn UTSW 9 107,990,453 (GRCm39) missense probably damaging 1.00
R6345:Bsn UTSW 9 107,984,554 (GRCm39) missense unknown
R6368:Bsn UTSW 9 107,988,513 (GRCm39) unclassified probably benign
R6574:Bsn UTSW 9 107,991,153 (GRCm39) missense possibly damaging 0.95
R6793:Bsn UTSW 9 107,991,814 (GRCm39) nonsense probably null
R6802:Bsn UTSW 9 107,987,823 (GRCm39) unclassified probably benign
R6943:Bsn UTSW 9 107,985,016 (GRCm39) missense unknown
R6999:Bsn UTSW 9 107,990,632 (GRCm39) missense probably benign 0.00
R7149:Bsn UTSW 9 107,993,520 (GRCm39) nonsense probably null
R7199:Bsn UTSW 9 107,992,533 (GRCm39) missense probably damaging 1.00
R7322:Bsn UTSW 9 108,003,620 (GRCm39) nonsense probably null
R7349:Bsn UTSW 9 107,987,982 (GRCm39) missense unknown
R7372:Bsn UTSW 9 107,987,718 (GRCm39) missense unknown
R7373:Bsn UTSW 9 107,990,683 (GRCm39) missense probably damaging 1.00
R7413:Bsn UTSW 9 108,016,690 (GRCm39) missense possibly damaging 0.61
R7473:Bsn UTSW 9 107,989,449 (GRCm39) missense probably damaging 1.00
R7482:Bsn UTSW 9 107,990,728 (GRCm39) missense probably damaging 0.98
R7530:Bsn UTSW 9 107,989,155 (GRCm39) missense probably damaging 1.00
R7549:Bsn UTSW 9 107,992,014 (GRCm39) missense probably benign 0.05
R7570:Bsn UTSW 9 107,990,742 (GRCm39) missense probably damaging 1.00
R7635:Bsn UTSW 9 107,988,189 (GRCm39) missense unknown
R7696:Bsn UTSW 9 107,991,700 (GRCm39) missense probably damaging 1.00
R7757:Bsn UTSW 9 107,991,939 (GRCm39) missense possibly damaging 0.90
R7868:Bsn UTSW 9 107,992,098 (GRCm39) missense possibly damaging 0.95
R7897:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.98
R8022:Bsn UTSW 9 107,991,603 (GRCm39) missense probably benign 0.01
R8056:Bsn UTSW 9 107,982,506 (GRCm39) missense
R8158:Bsn UTSW 9 107,987,232 (GRCm39) missense unknown
R8161:Bsn UTSW 9 108,016,729 (GRCm39) missense probably benign 0.20
R8225:Bsn UTSW 9 107,984,305 (GRCm39) missense
R8282:Bsn UTSW 9 107,984,890 (GRCm39) missense possibly damaging 0.73
R8296:Bsn UTSW 9 107,994,578 (GRCm39) missense probably benign 0.00
R8415:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8417:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8426:Bsn UTSW 9 108,003,772 (GRCm39) missense probably damaging 1.00
R8437:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8438:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8439:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8440:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8441:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8442:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8513:Bsn UTSW 9 107,991,709 (GRCm39) missense possibly damaging 0.65
R8529:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8535:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8546:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8548:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8549:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8682:Bsn UTSW 9 107,983,368 (GRCm39) missense
R8773:Bsn UTSW 9 107,987,704 (GRCm39) missense unknown
R8883:Bsn UTSW 9 107,990,227 (GRCm39) missense probably damaging 0.98
R8906:Bsn UTSW 9 107,984,752 (GRCm39) missense unknown
R9018:Bsn UTSW 9 107,994,488 (GRCm39) missense probably benign 0.06
R9070:Bsn UTSW 9 107,987,295 (GRCm39) missense
R9094:Bsn UTSW 9 107,988,052 (GRCm39) missense unknown
R9098:Bsn UTSW 9 107,990,173 (GRCm39) missense possibly damaging 0.65
R9128:Bsn UTSW 9 107,993,349 (GRCm39) missense probably benign 0.21
R9162:Bsn UTSW 9 107,987,883 (GRCm39) missense unknown
R9224:Bsn UTSW 9 107,982,686 (GRCm39) missense
R9230:Bsn UTSW 9 107,989,459 (GRCm39) missense probably damaging 1.00
R9233:Bsn UTSW 9 107,994,289 (GRCm39) missense probably benign 0.28
R9245:Bsn UTSW 9 107,993,292 (GRCm39) missense probably damaging 1.00
R9275:Bsn UTSW 9 107,988,819 (GRCm39) missense probably damaging 1.00
R9307:Bsn UTSW 9 107,992,993 (GRCm39) missense probably benign 0.01
R9343:Bsn UTSW 9 107,992,701 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,993,361 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,990,800 (GRCm39) missense probably damaging 1.00
R9378:Bsn UTSW 9 107,984,854 (GRCm39) missense possibly damaging 0.85
R9408:Bsn UTSW 9 108,016,652 (GRCm39) nonsense probably null
R9455:Bsn UTSW 9 107,988,531 (GRCm39) missense unknown
R9563:Bsn UTSW 9 107,984,616 (GRCm39) missense
R9615:Bsn UTSW 9 107,984,430 (GRCm39) missense
R9656:Bsn UTSW 9 107,994,407 (GRCm39) missense probably benign 0.09
R9698:Bsn UTSW 9 107,993,170 (GRCm39) missense probably damaging 1.00
X0028:Bsn UTSW 9 107,990,703 (GRCm39) missense probably damaging 1.00
X0066:Bsn UTSW 9 108,016,409 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 108,016,394 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 107,982,698 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGCTTCGAATTCGCTGCTG -3'
(R):5'- AACAGCACGGGTAGCTATG -3'

Sequencing Primer
(F):5'- GAATTCGCTGCTGTTCCAC -3'
(R):5'- TAGCTATGGTCATGAGCTAGACC -3'
Posted On 2020-09-15