Incidental Mutation 'R7960:G6pc'
ID650078
Institutional Source Beutler Lab
Gene Symbol G6pc
Ensembl Gene ENSMUSG00000078650
Gene Nameglucose-6-phosphatase, catalytic
SynonymsGlc-6-Pase, G6Pase, G6pt, Glc-6-Pase-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7960 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101367561-101377903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101376533 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 270 (G270R)
Ref Sequence ENSEMBL: ENSMUSP00000019469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019469]
Predicted Effect probably damaging
Transcript: ENSMUST00000019469
AA Change: G270R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019469
Gene: ENSMUSG00000078650
AA Change: G270R

DomainStartEndE-ValueType
acidPPc 56 196 2.28e-40 SMART
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 256 278 N/A INTRINSIC
transmembrane domain 291 308 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: The enzyme encoded by this gene is a multisubunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose. This gene is one of three glucose-6-phosphatase catalytic-subunit-encoding genes in mouse. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to die within a couple of weeks of weaning. Blood chemistry and glucose metabolism are abnormal as is glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,103,246 S82P possibly damaging Het
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Pole A G 5: 110,289,861 K95R possibly damaging Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Slc8a3 C T 12: 81,216,732 S627N probably benign Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sri A T 5: 8,064,586 Q180H probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in G6pc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:G6pc APN 11 101370723 missense probably damaging 1.00
IGL03068:G6pc APN 11 101370750 missense probably benign 0.01
R1988:G6pc UTSW 11 101367942 missense probably damaging 0.97
R3936:G6pc UTSW 11 101374603 missense probably benign
R4601:G6pc UTSW 11 101372741 missense probably damaging 1.00
R4677:G6pc UTSW 11 101376613 missense probably benign
R6073:G6pc UTSW 11 101367976 missense probably benign
R6304:G6pc UTSW 11 101367909 missense probably damaging 1.00
R7103:G6pc UTSW 11 101374587 splice site probably null
R7143:G6pc UTSW 11 101370723 missense probably damaging 1.00
R7438:G6pc UTSW 11 101376677 missense probably benign 0.17
R7499:G6pc UTSW 11 101376694 nonsense probably null
R8339:G6pc UTSW 11 101376488 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAGCCTCCGGAAGTATTGTCTC -3'
(R):5'- CAGATGCAAAGGGAACTGTTGC -3'

Sequencing Primer
(F):5'- CGGAAGTATTGTCTCATCACCATC -3'
(R):5'- TGCGCTCTTGCAGAAAGAC -3'
Posted On2020-09-15